Labshake search
Citations for Invivogen :
251 - 300 of 665 citations for 6 Chloro 9 fluorobenz 9 isoquinoline 5 10 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen) and 5 µg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Biochemistry 2022Quote: ... Female Balb/c mice (6-8 weeks old) were immunized with 15 μg of peptide adjuvanted with 20 μg CpG (ODN1826, InvivoGen) and 500 μg Alhydrogel (InvivoGen ...
-
bioRxiv - Immunology 2024Quote: ... 2cz-Tag-it co-culture with RAW 264.7 cells activated for 6 hours with 1.5 ug/ml Ultrapure LPS from E.coli O111:B4 (InvivoGen, Cat#tlrl-3pepls) and 2cz cultured with 50 ng/ml of its strong agonist peptide SIYRYYGL (GenScript ...
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Physiology 2019Quote: ... or the PI3K inhibitor wortmannin (10 μM; InvivoGen) to inhibit Akt activation for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IL-10 cells were purchased from Invivogen (catalog no ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Cancer Biology 2021Quote: ... 6-8 weeks old CM knock-in mice were injected intraperitoneally with polyinosinic–polycytidylic acid [poly (I:C)] (InvivoGen, tlrl-picw-250) at 14 mg/kg/dose every other day for a total of 7 doses ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated for 6 h with the indicated concentration of either High Molecular Weight (HMW) Poly(I:C) (InvivoGen, tlrl-pic) or Poly(I:C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the entire contents of the 12-well was transferred to a 6-well and supplemented with 0.2 μg/mL puromycin (Invivogen ant-pr). Cells were analyzed daily and spun at 125 × g for 5 min at 4 °C approximately once per week to fully refresh media ...
-
bioRxiv - Bioengineering 2024Quote: ... this clone was used to generate a stable pool harboring the human glycosyltransferase gene ST6GAL1 via transfection with a plasmid containing the coding sequence of human beta-galactoside alpha-2,6-sialyltransferase 1 isoform a (hSTGAL1) (GenBank NP_001340845.1) and expressed from a composite promoter mCMV-hEF1-HTLV (InvivoGen, San Diego, CA) in a derivative of pcDNA3.1(+ ...
-
bioRxiv - Biophysics 2021Quote: ... Media was supplemented with 5 µg/ml Plasmocin (Cat# ant-mpp, InvivoGen) as a prophylactic against mycoplasma contamination.
-
bioRxiv - Neuroscience 2019Quote: ... Cells were selected in the presence of 5 µg/ml puromycin (Invivogen) for 48 hours before functional validation of sgRNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with either 17-AAG (17A, ant-agl-5, InvivoGen), celastrol (Cel ...
-
bioRxiv - Cell Biology 2021Quote: ... the R332 cell line was supplemented with 5 μg/ml Blasticidin (Invivogen) and 250 μg/ml Zeocin (Invivogen) ...
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Immunology 2023Quote: ... HEK293-C34 cells were gifted by Y Matsuura at Osaka University and maintained in high-glucose DMEM (Nacalai Tesque) containing 10% FBS and 10 μg/mL blasticidin (solution) (InvivoGen, California, USA), and the exogenous expression of ACE2 and TMPRSS2 was induced by the addition of doxycycline hydrochloride (1 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Microbiology 2019Quote: ... and 10 μg/mL blasticidin (InvivoGen #ant-bl-1) for 3 days ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS ...
-
bioRxiv - Immunology 2021Quote: ... mixed with 10 µg CpG ODN 1668 adjuvant (InvivoGen). The following antigens were used ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were selected with 10 µg/mL blasticidin (Invivogen) for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2’3’-cGAMP (10 μg/ml, tlrl-nacga23, Invivogen). For AsiSI or I-PpoI nuclease induced DSBs ...
-
bioRxiv - Microbiology 2021Quote: ... cells were treated with 10 μg/mL Blasticidin (InvivoGen), 1 mg/mL Zeocin (InvivoGen) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were treated with 10 μg/ml LPS (Invivogen) for 6h.
-
bioRxiv - Microbiology 2021Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS.
-
bioRxiv - Immunology 2020Quote: ... Poly (I:C) (TLR3; vac-pic; Invivogen, 10 μg /ml), R837 (TLR7 ...
-
bioRxiv - Immunology 2019Quote: ... and 10 mg/mL Normocin (InvivoGen, San Diego, CA). Shortly before stereotactic injection ...
-
bioRxiv - Microbiology 2019Quote: ... 10 μg/mL blasticidin (InvivoGen, catalogue #ant-bl-1), or both ...
-
bioRxiv - Immunology 2021Quote: ... Protein vaccines were administered with 1:10 AdjuPhos (Invivogen).
-
bioRxiv - Biophysics 2021Quote: ... 10 ug/mL Blasticidin (InvivoGen, cat. # ant-bl-1).
-
bioRxiv - Biophysics 2021Quote: ... 10 ug/mL Blasticidin (InvivoGen, cat. # ant-bl-1) and 100 ug/mL Zeocin (Thermofisher ...