Labshake search
Citations for Invivogen :
251 - 300 of 753 citations for 10 14 Cadinene 4 5 Diol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2021Quote: ... at 5 μg/mL or the TLR4 agonist lipopolysaccharide (LPS; Invivogen) at 100 ng/mL or the TLR9 agonist class A CpG ODNs (CpG-A ...
-
bioRxiv - Immunology 2020Quote: ... and for TLR9 stimulation 5 µg/ml ODN1826 (tlrl-1826, InvivoGen). Unstimulated DC received no additives ...
-
bioRxiv - Neuroscience 2023Quote: ... with addition of 100 μg/mL G418 (Invivogen, #ant-gn-5) in case of GL261-tdTomato+Luc+ cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... or with 5 ug/ml OVA peptide (a.a.257-264, InvivoGen) for 4-5 hr in the presence of Golgi Stop (1/1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and selected with 5 μg/ml blasticidin (Invivogen, ant-bl-10p). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombined cells were selected with 5 μg/mL blasticidin S (InvivoGen) and 250 μg/mL hygromycin B (Roche Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... and RIG-I agonist (5’ triphosphate hairpin RNA, 3p-hpRNA, Invivogen). CHME-5xISRE-Nluc cells were maintained in DMEM supplemented with 10% FBS and pen/strep with 0.1 mg/ml hygromycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were selected under either 5 μg/ml Blasticidin-S (Invivogen) for two weeks or 5 μg/ml Puromycin (Invivogen ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2022Quote: ... and stimulated with 2.5 μg/mL R848 (Invivogen, tlrl-r848-5) and 1,000 U/mL human recombinant IL-2 (ImmunoTools ...
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: ... Stable transfectants were selected with Blasticidin S (5 μg/mL, Invivogen), puromycin (1 μg/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... lipopolysaccharide (LPS; 10 µg/mL; tlrl-eblps; InvivoGen), single-stranded DNA (ssDNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 μL of 10 μg/mL PMA (InvivoGen) dissolved in DMSO was added to 4 mLs of media for a final concentration of 20 ng/mL or approximately 32 nM PMA ...
-
bioRxiv - Biophysics 2021Quote: ... Media was supplemented with 5 µg/ml Plasmocin (Cat# ant-mpp, InvivoGen) as a prophylactic against mycoplasma contamination.
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with either 17-AAG (17A, ant-agl-5, InvivoGen), celastrol (Cel ...
-
bioRxiv - Cell Biology 2021Quote: ... the R332 cell line was supplemented with 5 μg/ml Blasticidin (Invivogen) and 250 μg/ml Zeocin (Invivogen) ...
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Biochemistry 2024Quote: ... 5 μg/ml or 45 μg/ml Blasticidin S (InvivoGen, Toulouse France) was added to the culture to select transduced cells.
-
bioRxiv - Molecular Biology 2024Quote: ... media was removed and cells were activated with 5 mM ATP (Invivogen) in OptiMem (Thermo Fisher ...
-
bioRxiv - Immunology 2024Quote: ... or poly I:C at 20μg/mL (Invivogen, Cat no. tlrl-pic-5). Poly I:C was complexed with Lyovec for transfection prior to stimulation.
-
bioRxiv - Immunology 2023Quote: ... HEK293-C34 cells were gifted by Y Matsuura at Osaka University and maintained in high-glucose DMEM (Nacalai Tesque) containing 10% FBS and 10 μg/mL blasticidin (solution) (InvivoGen, California, USA), and the exogenous expression of ACE2 and TMPRSS2 was induced by the addition of doxycycline hydrochloride (1 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS ...
-
bioRxiv - Immunology 2021Quote: ... mixed with 10 µg CpG ODN 1668 adjuvant (InvivoGen). The following antigens were used ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were selected with 10 µg/mL blasticidin (Invivogen) for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2’3’-cGAMP (10 μg/ml, tlrl-nacga23, Invivogen). For AsiSI or I-PpoI nuclease induced DSBs ...
-
bioRxiv - Microbiology 2021Quote: ... cells were treated with 10 μg/mL Blasticidin (InvivoGen), 1 mg/mL Zeocin (InvivoGen) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were treated with 10 μg/ml LPS (Invivogen) for 6h.
-
bioRxiv - Microbiology 2021Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS.
-
bioRxiv - Immunology 2020Quote: ... Poly (I:C) (TLR3; vac-pic; Invivogen, 10 μg /ml), R837 (TLR7 ...
-
bioRxiv - Immunology 2021Quote: ... Protein vaccines were administered with 1:10 AdjuPhos (Invivogen).
-
bioRxiv - Biophysics 2021Quote: ... 10 ug/mL Blasticidin (InvivoGen, cat. # ant-bl-1).