Labshake search
Citations for Invivogen :
201 - 250 of 603 citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... wildtype C57BL/6 were immunized by intraperitoneal injection of 5 µg Spike protein (5 µg, Bio-Techne) in presence of 10 µg CpG adjuvant (10 µg, ODN1826, Invivogen), followed by two reimmunization steps of 5 µg Spike protein in 10 µg CpG adjuvant every 15 days for a total of three immunizations.
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Physiology 2019Quote: ... or the PI3K inhibitor wortmannin (10 μM; InvivoGen) to inhibit Akt activation for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and IL-10 cells were purchased from Invivogen (catalog no ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Cancer Biology 2020Quote: ... The RIG-I specific ligand 3p-hpRNA and the MDA5/TLR3 ligand poly(I:C) HMW (High Molecular Weight) were from Invivogen.
-
bioRxiv - Cell Biology 2023Quote: ... mice were intraperitoneally injected once every other day for five total injections with 15 mg/kg high molecular weight polyinosinic-polycytidylic acid (polyI:C) (InvivoGen). In all experiments ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Cells were stimulated as follows: (1) stimulated with 1 μg/ml high-molecular mass poly(I:C) (Invivogen, tlrl-pic) transfected with 2 μg/ml Lipofectamin 2,000 (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... mice were intraperitoneally injected once every other day for five total injections with 15 mg/kg high molecular weight polyinosinic-polycytidylic acid (polyI:C) (InvivoGen). Mice used for experiments were at least 10-weeks following polyI:C administration ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we used 3.125 ng/μl of high molecular weight (HMW) poly(I:C) in 0.9% NaCl (Invivogen, San Diego, CA, USA) with an average size of 1.5 – 8 kb ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Microbiology 2019Quote: ... and 10 μg/mL blasticidin (InvivoGen #ant-bl-1) for 3 days ...
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS ...
-
bioRxiv - Immunology 2021Quote: ... mixed with 10 µg CpG ODN 1668 adjuvant (InvivoGen). The following antigens were used ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were selected with 10 µg/mL blasticidin (Invivogen) for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2’3’-cGAMP (10 μg/ml, tlrl-nacga23, Invivogen). For AsiSI or I-PpoI nuclease induced DSBs ...
-
bioRxiv - Microbiology 2021Quote: ... cells were treated with 10 μg/mL Blasticidin (InvivoGen), 1 mg/mL Zeocin (InvivoGen) ...
-
bioRxiv - Microbiology 2022Quote: ... cells were treated with 10 μg/ml LPS (Invivogen) for 6h.
-
bioRxiv - Microbiology 2021Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS.
-
bioRxiv - Immunology 2020Quote: ... Poly (I:C) (TLR3; vac-pic; Invivogen, 10 μg /ml), R837 (TLR7 ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Blasticidin (5-10 µg/ml; Invivogen; ant-bl).
-
bioRxiv - Immunology 2019Quote: ... and 10 mg/mL Normocin (InvivoGen, San Diego, CA). Shortly before stereotactic injection ...
-
bioRxiv - Microbiology 2019Quote: ... 10 μg/mL blasticidin (InvivoGen, catalogue #ant-bl-1), or both ...
-
bioRxiv - Immunology 2021Quote: ... Protein vaccines were administered with 1:10 AdjuPhos (Invivogen).
-
bioRxiv - Biophysics 2021Quote: ... 10 ug/mL Blasticidin (InvivoGen, cat. # ant-bl-1).
-
bioRxiv - Biophysics 2021Quote: ... 10 ug/mL Blasticidin (InvivoGen, cat. # ant-bl-1) and 100 ug/mL Zeocin (Thermofisher ...
-
bioRxiv - Immunology 2020Quote: ... and 10 mg mL−1 of poly(I:C) (InvivoGen) were used as positive controls for these experiments ...
-
bioRxiv - Immunology 2019Quote: ... JNK pathway was blocked by SP600125 (10 µM; Invivogen). Rapamycin (10 nM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... with the addition of blasticidin (10 μg ml1; Invivogen) and zeocin (Invivogen ...
-
bioRxiv - Genomics 2020Quote: ... 10 µg/mL of blasticidin (ant-bl-05, Invivogen), puromycin (P9620 ...
-
bioRxiv - Immunology 2022Quote: ... and 10 mg/mL blasticidin (InvivoGen, #ant-bl-1)] every other passage to maintain positive selection of reporters.
-
bioRxiv - Microbiology 2022Quote: ... 10 μg/ml blasticidin (InvivoGen, Cat# ant-bl-1) and 1% PS.