Labshake search
Citations for Invivogen :
151 - 200 of 1242 citations for 7 Bromoacetyl 6 ethyl 1 2 3 4 tetrahydro 1 1 4 4 tetramethylnaphthalene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... Treatment was initiated when tumors reached 5–6 mm in size and was given twice a week: 1 μg MPLA/tumor (#vac-mpls, InvivoGen) and indicated doses of mouse IFNγ (#485-MI/CF ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were grown until confluency and reseeded into 6-well dishes prior to addition of 1 µg/ml puromycin (InvivoGen) and 5 µg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Cell Biology 2023Quote: ... co-transfected cells were selected in culture medium supplemented with 3 μg/ml puromycin (Invivogen, ant-pr-1), until selection was complete after about 48 h ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Immunology 2022Quote: ... blasticidin (Invivogen, cat. no. ant-bl-1, at 10 μg ml−1), and zeocin (Invivogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1 µg/ml puromycin (Invivogen ant-pr-1).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were selected with 1 µg/mL puromycin (ant-pr-1, Invivogen) and pooled if the expression was homogeneous or cloned otherwise.
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 1:1 vol/vol AddaVax (InvivoGen vac-adx-10) to reach a final dose of 1 µg (S2P ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% P/S and 100 µg/ml Normocin (Invivogen ant-nr-1). 10 µg/ml of Blasticidin (Invivogen ant-bl-05 ...
-
bioRxiv - Immunology 2020Quote: ... plus the TLR-7 and TLR-8 agonist Resiquimod (R848, 2 µM, InvivoGen), for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30-60 min ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibiotic selection was applied two days after transfection (2 μg/mL puromycin (#ant-pr-1, Invivogen) for 3 days).
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Developmental Biology 2019Quote: ... and 1% Primocin (InvivoGen). Sphingosine-1-phosphate (0.2 - 2μM ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg pppRNA (Invivogen) was added to 100 μl LyoVec (Invivogen) ...
-
bioRxiv - Immunology 2020Quote: ... Pam2CGDPKHPKSF (FSL-1) (InvivoGen) (200ng/ml) ...
-
bioRxiv - Immunology 2019Quote: ... R406 (1 µM; InvivoGen) was used for inhibiting Spleen tyrosine kinase activation ...
-
bioRxiv - Cell Biology 2023Quote: ... diABzL (1 μM, Invivogen), cGAMP (10 μg ml-1 ...
-
bioRxiv - Immunology 2023Quote: ... 60uM Necrostatin-1 (Invivogen) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Fibroblasts were then transduced with lentiviruses and selected with 1 μg/mL puromycin for 1 week before being used (ant-pr-1, Invivogen, USA).
-
bioRxiv - Bioengineering 2024Quote: ... this clone was used to generate a stable pool harboring the human glycosyltransferase gene ST6GAL1 via transfection with a plasmid containing the coding sequence of human beta-galactoside alpha-2,6-sialyltransferase 1 isoform a (hSTGAL1) (GenBank NP_001340845.1) and expressed from a composite promoter mCMV-hEF1-HTLV (InvivoGen, San Diego, CA) in a derivative of pcDNA3.1(+ ...
-
bioRxiv - Immunology 2021Quote: ... were transduced 3 times with lentivirus containing supernatant and selected with 1 μg/ml Puromycin (Invivogen, San Diego, USA). Surviving cells were expanded and referred to as HEK293 luciferase reporter cells.
-
bioRxiv - Microbiology 2020Quote: ... DNA ratio of 3:1 according to manufacturer’s instructions or with Poly(I:C) (LMW)/LyoVec™ (tlrl-picwlv, InvivoGen). The treatment was administered as indicated ...
-
bioRxiv - Immunology 2020Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant (Invivogen) to reach a final concentration of 0.009 or 0.05 mg/mL antigen ...
-
bioRxiv - Immunology 2022Quote: ... and zeocin (Invivogen, cat. no. ant-zn-1, at 200 μg ml−1).
-
bioRxiv - Neuroscience 2023Quote: ... and kept in media with 1 µg/mL Puromycin (Invivogen, ant-pr-1). To induce LRP10 expression ...
-
bioRxiv - Molecular Biology 2023Quote: ... P0883) or 1 μg ml−1 flagellin from Salmonella typhimurium (Invivogen, tlrl-stfla), respectively ...
-
bioRxiv - Immunology 2024Quote: ... 100 μg EVSpikeM+P (1:1 mixed with Alhydrogel, InvivoGen, vac-alu-250) intramuscularly in the quadriceps (day 0) ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2×106 cells were nucleofected with 1 μg TetO targeting vector and 1 µg of PX459-ch15_gRNA/Cas9) as described above and treated with 1 µg/ml of puromycin (InvivoGen, ant-pr-1) 48h after transfection for 3 days to select cells for insertion of the TetO cassette ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Microbiology 2020Quote: ... Human CD14+ monocytes (2×106/ml) were pre-incubated with human anti-Dectin-1 (10μg/ml, Invivogen), anti-TLR2 blocking antibodies (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were transferred into 10 cm dishes and selected with 2 µg ml-1 puromycin (InvivoGen). After 7-10 days ...
-
bioRxiv - Immunology 2022Quote: ... 2 µg/mL) for 6 hr using LyoVecTM (InvivoGen, tlrl-patc) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein translation was inhibited with 50 µg·mL-1 of puromycin (ant-pr-1, Invivogen).
-
bioRxiv - Immunology 2020Quote: ... RBD-SpyVLP was mixed 1:1 (25 µL + 25 µL) with AddaVax adjuvant (Invivogen). Mouse experiments were performed according to the UK Animals (Scientific Procedures ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 μg ml−1 blasticidin and 25 μg ml−1 G418 (all from Invivogen).
-
bioRxiv - Cancer Biology 2023Quote: ... 0.2 μg/mL hydrocortisone and 50 μg mL-1 Primocin (InvivoGen #ant-pm-1). HIMEC cells used for chip conditions were between passage 6 and 8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transduced cells were selected using 1 μg/mL puromycin (InvivoGen, cat. ant-pr-1).
-
bioRxiv - Immunology 2022Quote: ... immunization with 50 µg TNP-KLH prepared with 1/3 volume of either alum or aluminum hydroxide gel (alhydrogel, Invivogen); 20 µg recombinantly produced trimer-stabilized HA (see below ...
-
bioRxiv - Immunology 2023Quote: Immune responses were induced in 6-12-week-old male and female mice by subcutaneous immunization in the right FP with 5 μg (for HA experiments) or 10 μg (for hapten-carrier experiments) supplemented with 1/3 volume alhydrogel adjuvant (Invivogen). In S1pr2-Tomato mice ...
-
bioRxiv - Microbiology 2019Quote: ... blasticidin (1 μg/mL, Invivogen) was added to media ...
-
bioRxiv - Neuroscience 2020Quote: ... Puromycin (1 μg/ml, InvivoGen) was added for two days from DIV2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Blasticidin (Invivogen: ANT-BL-1) was supplemented into media 48h post-transduction for relevant plasmid (LRT2B ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mg/mL Zeocin (InvivoGen), 2 μg/mL Puromycin (Sigma-Aldrich) ...