Labshake search
Citations for Invivogen :
101 - 150 of 323 citations for Mouse NLR Family CARD Domain Containing 4 NLRC4 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... the differentiation medium was replaced with fresh medium containing 10 µg/mL of Pam3CSK4 (Invivogen). After 2 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected in a medium containing 400 μg/mL hygromycin B Gold (InvivoGen) for 3 days.
-
bioRxiv - Microbiology 2024Quote: ... cells were passaged in selection medium containing 10 µg/ml blasticidin (ant-bl-1, InvivoGen). BEAS-2B-Cas9 were later transduced with lentiviruses encoding for GSDMD ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 10 mg/kg anti-CTLA-4 (clone 9D9, cat. mctla4-mab10, InvivoGen). Antibodies were administered twice weekly for a maximum of four weeks.
-
bioRxiv - Bioengineering 2021Quote: ... The media was replaced with selection media containing 0.005 mg/mL Blasticidin (InvivoGen ant-bl-5b) and 0.1 mg/mL Zeocin (InvivoGen ant-zn-5b) ...
-
bioRxiv - Bioengineering 2020Quote: ... with agitation (200 rpm) at 37 °C containing the antibiotic zeocin (InvivoGen, San Diego, CA, USA) at a concentration of 20 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... The medium was changed to cell culture medium containing 1 μg/ml zymosan (InvivoGen Europe, France), 10 ng/ml FSL1 (InvivoGen) ...
-
bioRxiv - Microbiology 2022Quote: ... Stable cells were selected with medium containing 10 μg/ml of blasticidin (InvivoGen; ant-bl-1) and then transduced with retrovirus particles containing pQCXP GFP-LMP1 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells underwent selection with media containing 10 μg/mL of blasticidin (Invivogen; ant-bl-1) for two weeks ...
-
bioRxiv - Immunology 2021Quote: ... these were co-cultured 1:1 in complete RPMI containing OVA peptide (5 mg/mL, InvivoGen) and recombinant TGFβ (1 ng/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... The organoids were cultured in IMDM medium containing 20% FBS supplemented with antibiotics and normocin (Invivogen) for 6 days ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant RBD protein containing a C-terminal 6xHis tag was formulated with the Alhydrogel adjuvant (Invivogen) and each vaccine dose contained 5 μg of RBD and 500 μg of aluminum hydroxide ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transiently transfected with an NF-κB containing reporter construct plasmid (pNifty-Luc™, InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... and containing 10 µg·mL−1 blasticidin and 100−1 µg·mL zeocin (InvivoGen, San Diego, CA, USA), for selection of cells expressing NF-κB-SEAP and IRF-Luc reporters.
-
bioRxiv - Cell Biology 2022Quote: ... Stable cell lines were selected by culturing cells in medium containing 2.5 μg/ml phleomycin (InvivoGen) and/or 10 μg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng mL-1 full-length flagellin (FFLG) (containing 0.01% sucrose; tlrl-pstfla; Invivogen, CA, USA); 50 µg mL-1 lipooligosaccharides (LOS ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were harvested 24 hours later and plated in medium containing 1 µg/ml Puromycin (InvivoGen) to select for transduced cells ...
-
bioRxiv - Cell Biology 2024Quote: ... The cell line was maintained as above in medium containing 5 µg/ml of blasticidin (Invivogen) and 100 µg/ml of hygromycin B (Invivogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... 800ng-1μg of RNA was reverse transcribed in a mix containing M-MLV reverse transcriptase (Invivogen), dNTP mix (Biobasic) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cultures were maintained in media containing 50% WRN conditioned media supplemented with 1mg/mL primocin (InvivoGen), 1mM N-Acetylcysteine ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Immunology 2020Quote: ... the cells were primed for 4 h with 500 ng/mL ultrapure LPS (InvivoGen). The supernatant was discharged and macrophages were infected with trypomastigote forms of T ...
-
bioRxiv - Immunology 2021Quote: ... cells were sorted in wells pre-seeded with human CD40 ligand-expressing MS40L cells (5,000 cells/well) and containing 2.5µg/ml CpG ODN2006 (tlrl-2006; InvivoGen), 5µM CHK2 kinase inhibitor II ...
-
bioRxiv - Biochemistry 2022Quote: ... and stably integrated cells were selected and maintained in media containing either zeocin (100 μg/mL; Invivogen), puromycin (500 ng/mL ...
-
bioRxiv - Immunology 2019Quote: ... before being cultured for indicated time points in FCS-free medium containing 1 µg/ml LPS (Invivogen), 1 μg/ml synthetic (B ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were trypsinized and re-plated in media containing 100 µg/mL hygromycin (InVivogen, ant-hg-1) to begin selection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isolated B cells were resuspended in B-LCL-medium containing 2.5 μg/ml CpG ODN 2006 (InvivoGen) and 30 μg/ml holo-transferrin (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2023Quote: ... and PRR expression was maintained by growing the cells in media containing Blasticidin (ant-bl-05, InvivoGen), Zeocin (ant-zn-05 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were transduced with lentiviral constructs containing the reporter and cells were then selected with hygromycin (Invivogen) for one week ...
-
bioRxiv - Immunology 2019Quote: ... HBV Pol and HBcAg in pVAC1 vector (Invivogen, 50 μg/mouse ea.); the group of mice immunized with empty vector VLV received empty pVAC1 vector (150 μg/mouse) ...
-
bioRxiv - Immunology 2020Quote: ... mouse RAW macrophages (RAW-Lucia ISG, RAW-Lucia ISG-KO-cGAS, Invivogen) were cultured in DMEM (Thermo Fisher cat ...
-
bioRxiv - Immunology 2023Quote: ... LPS-primed mouse BMDMs were transfected with 2 μg poly(dA:dT) (InvivoGen) using Lipofectamine 3000 and incubated for 6 h.
-
bioRxiv - Immunology 2023Quote: ... mouse NIH/3T3 fibroblasts were transfected with NotI-linearized pUNO1 vectors (Invivogen) encoding human BAFF (CD257 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 50 µL of the working solution of the QUANTI1Luc 4 Lucia/Gaussia reagent (Invivogen) was added ...
-
bioRxiv - Genomics 2019Quote: WI-38 fibroblasts (purchased from ECCAC) were cultured in Dulbecco’s Modified Eagle’s medium (DMEM) containing 10% FBS and 1X Primocin (Invivogen) at 37°C and 3% oxygen ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Genomics 2021Quote: ... Cells were selected with 60% BRL conditioned medium containing 0.8 µg/mL puromycin for the Tir1 knock-in and 2.5 µg/mL blasticidin (Invivogen) for the AID-Dam knock-in lines ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cells were then transferred to the new YEA agar plate containing antibiotics [100 μg/mL G418 (InvivoGen) or 100 μg/mL nourseothricin (Gold Biotechnology)] and incubated at 32°C for at least 3 days to select the transformants ...
-
bioRxiv - Immunology 2022Quote: 20 µg/mouse poly(I:C) (HMW) VacciGrade™ (Invivogen, San Diego, CA, USA) and 20 µg/mouse 3pRNA (synthesized by AG Hartmann ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated with a human-mouse hybrid aCD20 (InvivoGen hcd20-mab10, 5 ng/ml), added to wells at 40,000 cells per well ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Mycostrip detection kit (Invivogen). Cells were routinely screened for indicatiors of pluripotency OCT4 ...
-
bioRxiv - Immunology 2021Quote: ... were transduced 3 times with lentivirus containing supernatant and selected with 1 μg/ml Puromycin (Invivogen, San Diego, USA). Surviving cells were expanded and referred to as HEK293 luciferase reporter cells.
-
bioRxiv - Molecular Biology 2021Quote: ... containing the respective shRNA sequences (shINTS3: GCTGTGACCTCATTCGCTACA, shINTS6: ACCACTAATGATTCGATAATA, shINTS7: GCAGTAAAGAGACTTGCTATT) and 2.5 µg/ml puromycin (InvivoGen, #ant-pr) selection ...
-
bioRxiv - Microbiology 2021Quote: ... Two days post-transfection the media was replaced with DMEM containing 0.5% fetal bovine serum and NOD1 or NOD2 agonist [1 μg/ml C12-iE-DAP (Invivogen)+ 10 ng/ml human interferon gamma (AbD serotec ...
-
bioRxiv - Immunology 2022Quote: Mice were injected subcutaneously with a total volume of 200ul containing 100ug TRP2180-188 peptide and 50ug poly(I:C) (InvivoGen) formulated in in PBS ...
-
bioRxiv - Microbiology 2020Quote: ... filtered through sterile miracloth and pipetted on a double selective PDA plate containing 0.1 M Tris pH 8 supplemented with 100 μg/ml hygromycin (Duchefa) and 100 μg/ml zeocin (InvivoGen). Double drug resistant colonies were selected after three days and monospored on a new plate supplemented with both drugs ...
-
bioRxiv - Immunology 2021Quote: ... Flow through sera was then applied to a gravity flow column containing 1 mL Peptide M-sepharose resin (InvivoGen) to purify IgA ...