Labshake search
Citations for Invivogen :
101 - 150 of 488 citations for Anion Exchange Membranes Thickness 10 13 µm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Addavax (Invivogen, cat. Vac-adx-10) and Emulsigen D (MVP Adjuvants) ...
-
bioRxiv - Immunology 2024Quote: ... with 10 μg/ml Blasticidin (Invivogen). HEK-293T cells45 were also maintained in complete DMEM ...
-
bioRxiv - Biochemistry 2024Quote: ... and 10 μg/mL blasticidin (InvivoGen). HEK 293T cells were grown at 37°C under 5% CO2 in DMEM supplemented with 10% FBS ...
-
bioRxiv - Systems Biology 2021Quote: ... 10% U.S Origin FBS (GenClone #25-514) with 10 μg/mL hygromycin B ([Invivogen ant-hg-1). Cells were cultured in T-25 ...
-
bioRxiv - Immunology 2023Quote: ... FO B cells were sorted (the gating strategy is shown in Figure S4A) and stimulated with 2.5 µM CpG (InvivoGen) and nicotine (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected 24 h after transfection with either 10 μg·mL-1 Blasticidin S or 10 μg·mL-1 G418 (both InvivoGen). Gene disruptions were confirmed either by immunoblotting (forB- and forG- ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 µg/mL of blasticidin (InvivoGen).
-
bioRxiv - Cell Biology 2021Quote: ... 10 μg/ml poly(I:C) (HMW, Invivogen) or 1 μg/ml LPS (from Escherichia coli strain 0127:B8 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10 μg ml-1 blasticidin (InvivoGen) and independent clones obtained by limiting dilution ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 μg mL-1 of Blasticidin (Invivogen) and 1000 μg mL-1 G418 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... selecting with 10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... 10-15 µg mL-1 G418 (InvivoGen), 50 µg mL-1 hygromycin (InvivoGen ...
-
bioRxiv - Microbiology 2020Quote: ... and puromycin at 10 µg/ml (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... and 10 µg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 μg/mL blasticidin (Invivogen) to maintain TMPRSS2 expression ...
-
bioRxiv - Immunology 2020Quote: ... CpG2006 (TLR9; tlrl-2006; Invivogen, 10 μM), Flagellin (TLR5 ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 µg/mL of blasticidin (InvivoGen). MDBK-t2 cells were seeded into 24-well plates at 1 × 105 / well and incubated at 37°C in a 5% CO2 incubator overnight ...
-
bioRxiv - Immunology 2022Quote: ... OVA + CpG (10 μg, Invivogen, Cat# ODN1826) and OVA + Alum (200 μg Sigma ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 μg saponin (InvivoGen, vac-quil) in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
bioRxiv - Cancer Biology 2022Quote: ... LPS (10 μg/mL, InvivoGen tlrl-eblps), ssDNA (1 μg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or blasticidin (InvivoGen, 5 ∼ 10 µg/ml), as appropriate.
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... AddaVax (InvivoGen Cat t#vac-adx-10) was purchased as a 2x ready-to-use suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... PolyI:C (10 mg/mL, InvivoGen; tlrl-picw), FAS ligand (10 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µg/ml blasticidin (InvivoGen, ant-bl), or 800 µg/ml neomycin (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... For control purposes cells were stimulated with cytosolic 1 µg LPS using lipofectamine or nigericin (6.7 µM) (InvivoGen, tlrl-nig). 1% triton X100 was used as a lysis control in cell death assays (37) ...
-
bioRxiv - Cell Biology 2024Quote: ... iPSC-CMs at day 60 of differentiation were treated with 1-2 µM pevonedistat (Hycultec) or 750 ng MG-132 (InvivoGen) for three days ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2023Quote: ... we immunized two groups of BALB/c mice (n=10) with 5 µg protein antigens adjuvanted with 10 µg Monophosphoryl lipid A (MPLA, Invivogen) and 10 µg Quil-A (Invivogen ...
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...
-
bioRxiv - Systems Biology 2023Quote: ... selection began with 10 μg/mL blasticidin (InvivoGen). Cells were maintained in log growth conditions each day by diluting cell concentrations back to a 5 × 105 cells/mL (and replenishing blasticidin) ...