Labshake search
Citations for Invivogen :
101 - 150 of 1429 citations for 7 Bromo 3 4 dihydro 1H benzo e 1 4 diazepine 2 5 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Adenosine 5’-triphosphate disodium salt (ATP, CAS: 987-65-5), poly(dA:dT), and nigericin (Nig, CAS: 28643-80-3) were from InvivoGen. Cross linker disuccinimidyl suberate (DSS ...
-
bioRxiv - Microbiology 2021Quote: ... and LPS (100 ng / mL E. coli K12, k-eklps, Invivogen) with IFNγ (20 ng / mL ...
-
bioRxiv - Immunology 2019Quote: ... or LPS (O111:B4, E. coli, 1µg/2,5×105 cells Invivogen) was achieved using FuGeneHD (Promega ...
-
bioRxiv - Immunology 2023Quote: ... and LPS-EB (E. coli 0111:B4) were purchased from InvivoGen.
-
bioRxiv - Molecular Biology 2021Quote: ... or on solid YPD-agar (1% yeast extract, 2% peptone, 2% D-glucose, 2% agar) and selected with 100 µg/ml Zeocin® (InvivoGen). For small scale expression screening ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2020Quote: ... the medium was supplemented with 3 μM puromycin (InvivoGen, #ant-pr-1). Then ...
-
bioRxiv - Physiology 2022Quote: ... 1% P/S and 5 μg/mL plasmocin (Invivogen, CA). M-1 cells were grown on coverslips (for RNAScope ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
Identification of SLC25A46 interaction interfaces with mitochondrial membrane fusogens Mfn2 and Opa1bioRxiv - Biochemistry 2023Quote: ... Plasmids were transformed into SMD1163 by electroporation and grown on YPDS (1% yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol) zeocin (InvivoGen, ant-zn-1p) plates ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Immunology 2022Quote: ... 106 UCBMC were stimulated for 16h at 37°C in RPMI 1640 medium supplemented with 10% FBS in the presence or absence of 1 ug/mL LPS (TLR4 ligand, E. Coli 055:B5; Invivogen, San Diego CA). Brefeldin A (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... animals were injected intraperitoneally with 1 mg/kg of lipopolysaccharide (LPS endotoxin from E. coli 0111:B4 ultra-pure; InvivoGen, San Diego, CA) dissolved in saline ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: ... transformants were selected with 1-2 ug/mL of puromycin (Invivogen #ant-pr-1), then a single colony was isolated in two rounds of dilution and colony picking.
-
bioRxiv - Developmental Biology 2019Quote: ... supplemented with Primocin antibiotic (1:50, ant-pm-2, Invivogen), either in 24-well plates for maintenance ...
-
bioRxiv - Molecular Biology 2021Quote: ... We added 2 μg/ml puromycin (Invivogen, ant-pr-1) to the growth media 24 hours after transduction to select for resistant cells containing the gRNA and harvested the cells 72 hours after selection was added ...
-
bioRxiv - Bioengineering 2020Quote: ... and 1:1,000 (vol/ vol) primocin (Invivogen, ant-pm-2).
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... we added 2 μg/ml puromycin (Invivogen, ant-pr-1) to the growth media 24 hours after transduction ...
-
bioRxiv - Immunology 2023Quote: ... or 2 µg/ml poly(dA:dT) (Invivogen, tlrl-patn-1) by using Lipofectamine 2000 for 6 hr ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 μg ml-1 Primocin (#ant-pm-2; InvivoGen). NMR culture media was further supplemented with 1X non-essential amino acids (#11140-050 ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Immunology 2021Quote: ... these were co-cultured 1:1 in complete RPMI containing OVA peptide (5 mg/mL, InvivoGen) and recombinant TGFβ (1 ng/mL ...
-
bioRxiv - Microbiology 2020Quote: ... except that the protoplasts were transformed with 1μg of each split-marker cassette DNA and plated on medium containing 200 g.l−1 saccharose and 2 g.l−1 NaNO3 supplemented with 70 μg.ml−1 hygromycin (Invivogen, France) for single ΔBcflp1 or ΔBcflp2 mutants or 80 μg.ml−1 nourseothricin (Werner BioAgents ...
-
bioRxiv - Genomics 2022Quote: ... and then diluted 1:2 with ice cold PBS with 1% (v/v) primocin (InvivoGen). Material that filtered through a 70 μm cell strainer was collected and referred to as jejunal epithelial cell fraction one (IEC-1) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3- methyladenine (Invivogen), bafilomycin A1 (Invivogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 6-7 week-old BALB/c mice were ordered from Invivogen/Envigo and were allowed to acclimatize for 10 days prior to experimentation ...
-
Endothelial transmigration hotspots limit vascular leakage through heterogeneous expression of ICAM1bioRxiv - Immunology 2022Quote: ... a 2-day 1.5 μg/mL puromycin (InvivoGen, ant-pr-1) selection was performed ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1% Penicillin/Streptomycin and 0.1mg/mL Normocin (ant-nr-2, Invivogen). HEK-Blue selection (hb-sel Invivogen ...
-
bioRxiv - Genetics 2022Quote: ... supplemented with 100 μg ml−1 primocin (Invivogen, ant-pm-2), 10% BIT 9500 (Stemcell Technologies ...
-
SMDT1 variants impair EMRE-mediated mitochondrial calcium uptake in patients with muscle involvementbioRxiv - Genetics 2022Quote: ... blasticidin (2 μg/ml; # ant-bl-1; InvivoGen, San Diego, USA) was added to the medium to select for stably transduced SMDT1-V5 or GFP-V5 cells ...
-
bioRxiv - Genetics 2023Quote: ... supplemented with 100 μg ml−1 primocin (Invivogen ant-pm-2), 10% BIT 9500 (Stemcell Technologies 09500) ...
-
bioRxiv - Immunology 2021Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Microbiology 2022Quote: ... BALB/c mice were vaccinated via the intramuscular route with 3 μg of each respective protein with 1:1 mixture of Addavax (Invivogen) in a total volume of 50 μL ...
-
bioRxiv - Immunology 2023Quote: ... whole splenocytes from OT-1 mice were electroporated on day 3 after initial activation with 1 µg/mL OVA 257-264 peptide (InvivoGen), and cells were further expanded for 4 days with 200 U/mL rhIL-2 (NCI) ...
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Microbiology 2019Quote: ... Transduced cells were then selected with both 3 μg/mL puromycin (InvivoGen #ant-pr-1) and 10 μg/mL blasticidin (InvivoGen #ant-bl-1 ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Immunology 2023Quote: ... followed by the medium being replaced with fresh IFNγ (5 ng/ml) containing media for 2 h before treatment with indicated stimulations: MDP (100 μM, Invivogen), iE-DAP (100 μM ...
-
bioRxiv - Genetics 2023Quote: ... 5% CO 2 prior to stimulation under the same conditions with the following reagents and concentrations - Pam3Csk4 (Invivogen, Lot no.), LPS (Invivogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 10 days or 2 μg/mL puromycin (InvivoGen; #ant-pr-1) for 4 days to generate stable cell lines.
-
bioRxiv - Biochemistry 2022Quote: ... cells were selected with 2 μg/mL puromycin (Invivogen: ant-pr-1).