Labshake search
Citations for Invivogen :
101 - 150 of 152 citations for 4 1BBR TNFRSF9 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and 50 µL of the working solution of the QUANTI1Luc 4 Lucia/Gaussia reagent (Invivogen) was added ...
-
bioRxiv - Microbiology 2021Quote: ... the human monocyte cell line THP1-Blue expressing an NF-κB-inducible secreted embryonic alkaline phosphatase (SEAP) reporter gene (InvivoGen) were cultured in RPMI-1640 (Sigma Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... Soluble Fc-mDectin-1a containing the C-terminal extracellular domain of mouse Dectin-1a fused with the human IgG1 Fc domain was purchased from Invivogen. Overnight C ...
-
bioRxiv - Cancer Biology 2022Quote: ... vector with the KIH strategy “knob” human Fc domain(54) MLA2-arm of the TriTE was converted into a scFab and cloned into a pFUSE (InvivoGen) vector with the KIH strategy “hole” human Fc domain followed by OKT3 ...
-
bioRxiv - Microbiology 2020Quote: The DNA sequences of codon-optimized SARS-CoV-2 spike Receptor Binding Domain (S-RBD) and human ACE2 extracellular domain (hACE2-ECD) were cloned into a pFuse-Fc expression vector (Invivogen). A thrombin cleavage sequence was inserted between RBD and Fc to generate a cleavable human Fc tag for future studies ...
-
bioRxiv - Bioengineering 2022Quote: Non-glycosylated monoclonal human IgG1 antibody against human EGFR (hegfr-mab12, lot: EG12-39-01) and isotype control -Human IgG1 (bgal-mab1, lot: BG1-41-01) were purchased from InvivoGen. Human EGFR (Research Grade Cetuximab Biosimilar ...
-
bioRxiv - Microbiology 2021Quote: Human embryonic kidney HEK293T/17-hACE2 cells with stable expression of human angiotensin-converting enzyme ACE2 (AXON Neuroscience SE) were prepared by stable transfection of pDUO2-hACE2-TMPRSS2a (InvivoGen) with transfection reagent Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T cells that stably express human ACE2 (ACE2-293T) were cultivated in the presence of 2 μg/ml puromycin (Invivogen). Caco2 (human epithelial colorectal adenocarcinoma ...
-
bioRxiv - Immunology 2023Quote: ... The cDNAs were fused to the C terminus of human IgG1-Fc in the expression vector pFuse-hIgG1-Fc2 (InvivoGen). Constructs containing Clec12a or empty vector were transfected into Lx293 cells cultured with DMEM +10% FBS and Pen/strep (1mg/mL) ...
-
bioRxiv - Microbiology 2022Quote: ... Vero E6 cells stably expressing human TMPRSS2 were generated by lentiviral transduction followed by selection with blasticidin (40 μg/mL; Invivogen). SARS-CoV-2 strains hCoV-19/USA-WA1/2020 (NR-52281) ...
-
bioRxiv - Molecular Biology 2023Quote: ... was fused to the Fc region (CH2 and CH3 domains) and hinge region of the human IgG1 heavy chain in the pFUSE-Fc1 vector (InvivoGen). Jag1ECD-Fc protein was expressed in Expi293F cells grown in Expi293F expression medium at 37°C in an 8% CO2 incubator with constant shaking ...
-
bioRxiv - Immunology 2023Quote: ... for 2 h and then stimulated with 20 ng/mL of recombinant human mIL-1β (R&D) complexed with Lyovec (Invivogen). Activation was carried out for 18 h unless stated differently ...
-
bioRxiv - Immunology 2023Quote: The human monocytic THP-1 cell line (ATCC TIB-202) and the THP-1 DualTM reporter cell (InvivoGen, Thpd-nfis) were culture in RPMI supplemented with 10% heat-inactivated fetal calf serum ...
-
bioRxiv - Microbiology 2024Quote: HEK-Blue cells expressing human or murine TLR9 and carrying the NF-κB SEAP (secreted embryonic alkaline phosphatase) reporter gene (InvivoGen) were used according to the manufacturer’s instructions and adapted to assess TLR-specific NF-κB activity induced via live C ...
-
bioRxiv - Immunology 2024Quote: Assessment of TLR4 and TLR5 activity was implemented using human embryonic kidney (HEK)-Blue-mTLR4 and HEK-Blue-mTLR5 cells respectively (Invivogen) using a protocol as previously described (Allen et al. ...
-
bioRxiv - Immunology 2020Quote: ... The lyophilized powder was combined with 300 µg of CpG (Murine CpG, ODN 1826, Porcine, Rabbit, Human CpG ODN 2006 for pig and rabbit, InvivoGen, USA) which has been condensed with Polyethyleneimine (PEI ...
-
bioRxiv - Microbiology 2023Quote: The ADCC reporter assay was performed by using Jurkat-Lucia NFAT-CD16 cells (human FcγRIII, V158) (Invivogen, Cat# jktl-nfat-cd16) as effector cells according to the manufacturer’s instruction with modifications ...
-
bioRxiv - Bioengineering 2024Quote: ... a clonal 9xKO-hSTGAL1-expressing CHO parent was made to express human A1AT via transfection with a plasmid containing the coding sequence of human alpha-1-antitrypsin (hA1AT) (GenBank NP_000286.3) under a composite promoter mCMV-hEF1-HTLV (InvivoGen, San Diego, CA) in a pcDNA3.1/Zeo(+ ...
-
Vaccinia virus-based vaccines confer protective immunity against SARS-CoV-2 virus in Syrian hamstersbioRxiv - Immunology 2021Quote: ... boost 4 weeks later of 5 μg recombinant spike protein (aa 14-1209) in 1% alhydrogel (Invivogen) into the right hind limb ...
-
bioRxiv - Microbiology 2020Quote: ... thuringiensis-infected mice was intravitreally treated with the synthetic TLR2/4 inhibitor OxPAPC (Invivogen; 30 ng/μl) (WT+OxPAPC ...
-
bioRxiv - Cell Biology 2023Quote: ... Infected cells were selected 24 h post infection in 4 µg/ml Blasticidin (Invivogen, ant-bl-1) or 100 µg/ml of hygromycin (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... mice were primed by intraperitoneal injection of low molecular weight Poly(I:C) (LMW, InvivoGen; 4 mg/kg) followed 6h later by intraperitoneal challenge with LPS (L2630 ...
-
bioRxiv - Biochemistry 2024Quote: ... a fragment of recombinant DNA encoding either residues 21 to 220 of human CD44 or 25 to 224 of murine CD44 were subcloned into an in-house Fc pFUSE-based vector (Invivogen, pfuse-hg1fc1) with a Gly/Ser linker in between ...
-
bioRxiv - Immunology 2020Quote: The cell lines A549-Dual (adenocarcinoma human alveolar basal epithelial cells) and RAW-Lucia ISG (RAW-mouse macrophages) (InvivoGen, San Diego, CA, USA) were cultured in DMEM (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). Neurons infected with GCaMP6f as stated above were infected with AAV9-hSyn-Cre (Addgene #105553-AAV9 ...
-
bioRxiv - Immunology 2022Quote: The following in vivo treatment regimens were used in this study: DMXAA (5,6-dimethylxanthenone-4-acetic acid, Invivogen): 20mg/Kg intraperitoneal (i.p.) ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (InvivoGen ant-pm-1). For calcium imaging experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa Cyclin B1-GFP cells were grown in media containing 4 μg/ml blasticidin (Invivogen # ant-bl-05). HeLa Cyclin A2-GFP cells 25 were grown in media containing 9 μg/ml blasticidin (gifts of Francis Barr) ...
-
bioRxiv - Immunology 2022Quote: 50μg biotinylated NS1 protein or 50μg (4-hydroxy-3-nitrophenyl)-acetyl(15)-OVA (NP-OVA) was adsorbed to 100μg alhydrogel alum (InVivoGen) in a total of 200μL per mouse for 30 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... The protocol using HEK-Blue™-hTLR2 and HEK-Blue™-hTLR4 reporter cell lines expressing human TLR2 and TLR4 (InvivoGen, San Diego, CA) was employed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... and stimulated with 1 U/mL of IL-4 (Miltenyi) and 5 ng/mL IL-5 (Miltenyi) supplemented with 1μg/mL LPS (Invivogen) or 10μg/mL CpG ODN (Invivogen ...
-
bioRxiv - Biochemistry 2021Quote: PMA-differentiated THP1 macrophages in 24-well plates were pretreated with fatty acids (2.5 μM and 10 μM) for 30 min prior to stimulation with 4 μg/mL cGAMP (InvivoGen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl UV-treated sample was inoculated onto 4×104 cells/ well of HEK-Blue IFNα/β cells (InvivoGen) in 96-well plates ...
-
bioRxiv - Immunology 2023Quote: ... Culture supernatants from THP-1 Dual cells (20 µl) were mixed with QUANTI-Luc 4 Lucia/Gaussia reagent (Invivogen), and luminescence was measured by a luminometer ...
-
bioRxiv - Genetics 2023Quote: ... Ganciclovir selection was conducted for 4 days under 10 μM ganciclovir/culture medium (#sud-gcv; InvivoGen, San Diego, CA) after G418 selection or 8 days after single-cell sorting ...
-
bioRxiv - Immunology 2023Quote: ... or RPMI1640 (ATCC) supplemented with 10% FBS and 2 mM L-Gln (MC38) and 4 µg/mL Blasticidin (InvivoGen) (MC38-Her2-B2m-/-) ...
-
bioRxiv - Immunology 2020Quote: ... Animals received 1 μg of the TLR-2 ligand Pam3Cys-Ser-(Lys)4 trihydrochloride (Pam3Cys) (Invivogen, San Diego, CA, USA), 1 μg of the TLR-4 ligand LPS (Sigma-Aldrich Corp. ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded as 0.3*106 cells in 6-wells plate followed by treatment for 4 h with 333 nM of Torin 1 (InvivoGen) alone or in combination with 200 nM of Bafilomycin A1 for 1 h.
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Omicron Variant (B.1.1.529/BA.1) pLV-SpikeV11) and Omicron Variants (BA.4/BA.5) pLV-SpikeV13) were purchased from InvivoGen (San Diego, CA). The human T-Cell lymphoma Jurkat (E6-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... performing half media changes every 3-4 days with fresh NbActiv1 supplemented with PrimocinTM (ant-pm-1, InvivoGen, San Diego, California, USA). Cultures were incubated at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.