Labshake search
Citations for Invivogen :
1401 - 1450 of 2344 citations for Monobenzyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Immunology 2023Quote: ... 50 ng/mL CpG ODN 2006 (Invivogen), 10 ng/mL IL-2 (R&D Systems) ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2.5 mg/ml plasmocin prophylactic (Invivogen). At about 80% confluence ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 20 µg/mL of blasticidin (Invivogen) was added to the culture to select the transfectants ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg/mL plasmocin (ant-mpp, Invivogen), and cultured in a humidified incubator with 5% CO2 at 37 °C ...
-
bioRxiv - Bioengineering 2023Quote: ... and 200 µg/mL of hygromycin (Invivogen) for selection of cells transduced with the URoC1b genes ...
-
bioRxiv - Microbiology 2023Quote: ... and 1.5 μg/ml Blasticidin (InvivoGen, USA) respectively ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and Plasmocin prophylactic 5 µg/mL (Invivogen). COS7 and HeLaM cells for imaging experiments were seeded on glass-bottomed dishes (MatTek ...
-
bioRxiv - Biochemistry 2023Quote: ... and puromycin at 0.1 μg/ml (InvivoGen).
-
bioRxiv - Immunology 2023Quote: ... Normocin (50 mg/ml, InvivoGen, CA, USA), 1% Penicillin/Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... and 5 µg/mL prophylactic plasmocin (InvivoGen). Before passaging ...
-
bioRxiv - Cancer Biology 2024Quote: ... 50µg/mL Primocin (Invivogen, ant-pm-05), 10µM Forskolin (Sigma/Merck ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 2.5µg/ml of prophylactic plasmocin (InvivoGen) to prevent mycoplasma contamination during maintenance of the cells but was removed before any experimental assay (InvivoGen).
-
bioRxiv - Immunology 2024Quote: ... and activated with 1μg/mL CpG (Invivogen) for two days ...
-
bioRxiv - Immunology 2021Quote: ... 50-100 48-hour old embryos were treated with 100μM 2’3’-cGAMP (InvivoGen) in 1/3x sea water for 4 hours.
-
bioRxiv - Bioengineering 2021Quote: ... Each bolus vaccine dose (100 μL injection volume) contained 115 μg Alhydrogel (Invivogen) in PBS with 10 μg or 50 μg 2'3'-cGAMP (Invivogen ...
-
bioRxiv - Immunology 2022Quote: ... LPS-stimulated B cells were treated with 100 nM of Bafilomycin A1 (InvivoGen) for 3 h ...
-
bioRxiv - Immunology 2022Quote: ... and Alum/Alhydrogel 2% (lot #0001657855, InvivoGen, San Diego, CA, USA) was performed in the upper part of the right footpad ...
-
bioRxiv - Immunology 2021Quote: ... 2’-3’-cGAMP and c-di-UMP were purchased from Invivogen. EFV was purchased from Bristol-Myers Squibb.
-
bioRxiv - Cell Biology 2020Quote: ... selection for transduced cells was commenced by addition of 2.0 μg/ml puromycin or 300 μg/ml G418 (InvivoGen) or 8.0 μg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were seeded in a 96 well dish at 1.4×105 cells/mL (HEK-hTLR4) and 2.8×105 cells/mL (HEK-null2) in HEK detection media (Cat# hb-det3 Invivogen) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... DOX-inducible cell lines generated in the parental TetOn-HeLa cell line were supplemented with 500 μg/mL G418 + 0.5 μg/mL puromycin (Invivogen).
-
bioRxiv - Cell Biology 2022Quote: ... 1 μg μl-1 primocin (Invivogen ant-pm-1), 20 mmol/L HEPES at pH 7.4 and 25 μmol/L cytochalasin D.
-
bioRxiv - Immunology 2019Quote: ... BMDMs from WT or Tlr2-/-mice were stimulated by rCsHscB (20 μg/ml) or Pam3CSK4 (200 ng/ml) (Invivogen, US) and supernatants were used for ELISA.
-
bioRxiv - Cell Biology 2022Quote: ... Infected cells were selected by incubation in medium containing 200 µg/mL hygromycin B Gold or 3 µg/mL blasticidin S (InvivoGen) for 4 d ...
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Microbiology 2020Quote: ... were primed with LPS (10ng/ml for PBMCs and monocytes, 100ng/ml for monocyte-derived macrophages and monocyte-derived DCs, Invivogen) for 3 hr and then stimulated with heat-killed T ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines used for all mturboID-MS experiments were generated in HEK293 Flp-InTM T-RExTM cells as previously described14 and pool of stable transfectants selected with 200 μg/mL hygromycin (Multicell) and 5 μg/mL blasticidin (Invivogen). Expression of bait proteins were induced with 1 μg/mL tetracycline for 24 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... Infected cells were selected by incubation in medium containing 3 µg/mL blasticidin S or 200 µg/mL hygromycin B Gold (InvivoGen) for 4 d.
-
bioRxiv - Immunology 2019Quote: ... the same amount of Amlexanox was injected again intraperitoneally with 100 μg MDP (Invivogen) and 10ug of PAM3CSK4 ...
-
bioRxiv - Bioengineering 2023Quote: ... vaccines also contain an adjuvant of CpG1826/Alum (20 μg + 100 μg, respectfully, Invivogen), SNP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were routinely tested for mycoplasma detection with the kit (rep-mysnc-100, Invivogen).
-
bioRxiv - Biophysics 2023Quote: ... USA) in mTeSRTM Plus Basal Medium (Cat. No.100-11300) + Primocin (Cat. No.NC9392943, Invivogen). 3 x 105 cells/cm2 cells were seeded per well of a 6-well tissue culture plate ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 5 μg/ml poly(I:C) HMW (InvivoGen). Two hours after induction cell viability was measured with alamarBlue ...
-
bioRxiv - Immunology 2021Quote: ... 0.6 mg/ml monosodium urate crystals (MSU) (InvivoGen) for 6 h ...
-
bioRxiv - Immunology 2021Quote: ... 10ng/ml Pam3CSK4 (InvivoGen, Cat. no.# tlrl-pms.), 100ng/ml Poly I:C (InvivoGen ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2.5 mg/mL Plasmocin (InvivoGen, Cat ant-mpp). All cells were tested for mycoplasma contamination.
-
bioRxiv - Molecular Biology 2019Quote: ... cells were grown in 5µg/ml Hygromycin (Invivogen). PF cells were transfected using the same procedure ...
-
bioRxiv - Immunology 2021Quote: ... or 10mg/ml PI3 Kinase inhibitor (LY294002, Invivogen) as controls ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mg/ml Primocin (InvivoGen, #ant-pm-0.5), 1X B-27 supplement (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: ... mixed with 0.5 ml alum adjuvant (Alhydrogel, Invivogen) for each animal ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μg/mL Primocin (Invivogen ant-pm-05), 3 μM SB202190 (Peprotech 1523072) ...
-
bioRxiv - Genetics 2022Quote: ... at 1μg/mL or blasticidin (Invivogen, ant-bl) at 5μg/mL).
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 µg/mL hygromycin (InvivoGen, San Diego, CA) or 100 µg/mL nourseothricin (Gold Biotechnology ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 6 µg/mL of blasticidine S (InvivoGen) for 10 days ...