Labshake search
Citations for Invivogen :
1301 - 1350 of 1378 citations for 7 hydroxy 1H 1 2 4 triazolo 1 5 a pyrimidin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Immunology 2020Quote: ... NF-kB reporter monocytic cells (THP-1-XBlue) stably expressing a secreted embryonic alkaline phosphatase (SEAP) reporter inducible by NF-κB were purchased from InvivoGen (InvivoGen, San Diego, CA, USA). - ...
-
bioRxiv - Cancer Biology 2022Quote: ... Stably transduced cells were either selected by flow cytometry using BD FACSAria III cell sorter or 1μg/ml puromycin (InvivoGen, San Diego, USA, #ant-pr-1).
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2021Quote: Human PBMC or purified primary cDCs were cultured in RPMI 1640 media supplemented with 10% Fetal Bovine Serum (HyClone) alone or in the presence of either 1μg/ml 2’3’-c’diAM(PS)2 (Invivogen) or 5μg/ml Poly I:C (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 3-5 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) and 8 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Immunology 2022Quote: SiO2 crystals free of bacterial contamination (Nano-SiO2, diameter less than 100 nm, InvivoGen, #tlrl-sio-2) at a concentration of 10 mg/ml supplemented with phenol red ...
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
bioRxiv - Cell Biology 2022Quote: ... and were selected for ten to fourteen days with a selection medium (contains 1 μg/ml Blasticidin [Invivogen, #ant-bl], 200 μg/ml Hygromycin B gold [Invivogen, #ant-hg] and 1μg/mL Puromycin). Twenty four clones were screened for the mCherry signal visually with fluorescent microscope ...
-
bioRxiv - Immunology 2021Quote: ... Specific wells were pre-cultured for 2 hours with either 10mg/ml of TLR4 inhibitor (CLI-095, Invivogen) or 10mg/ml PI3 Kinase inhibitor (LY294002 ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Immunology 2021Quote: ... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... the cultures were incubated with or without a bacterial agonist cocktail (2ug/mL Pam3CSK4 (TLR1/2 agonist, InvivoGen), 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
bioRxiv - Microbiology 2023Quote: ... ACE2 and transmembrane serine protease 2 (TMPRSS2)-expressing A549 (ACE2-TMPRSS2-A549) cells were from Invivogen (#a549-hace2tpsa) and HEK293T were from ATCC (#CRL-11268) ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Microbiology 2021Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM cyclic di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... extraction buffer supplemented with a final concentration of 0.01% formic acid and 25nM c-di-GMP-Fluorinated internal standard (InvivoGen CAT: 1334145-18-4). Pelleted cells were mechanically disturbed with the Qiagen TissueLyser LT at 50 oscillations/second for 2 minutes.
-
bioRxiv - Cancer Biology 2023Quote: ... All cells were routinely confirmed to be negative for mycoplasma infection every 3–4 months using PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Biochemistry 2020Quote: ... parasites were cultured with anhydrotetracycline medium at 250 nM (aTc+, MilliporeSigma) for 2 days before blasticidin /aTc+ medium was used (blasticidin at 2.5 µg/mL, InvivoGen).
-
bioRxiv - Bioengineering 2022Quote: ... Human codon optimized Delta full-length SARS-CoV-2 Spike protein plasmid was synthesized by Invivogen (plv-spike-v8).
-
bioRxiv - Immunology 2021Quote: ... in the left and right mid-thighs with 50 µg MD39 and 500 µg alum (Alhydrogel adjuvant 2%; InvivoGen) per side ...
-
bioRxiv - Neuroscience 2021Quote: ... endotoxin levels in exosomes and iPS-Mg medium were measured using the HEK Blue LPS detection kit 2 (InvivoGen) following manufacturers’ instructions ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... experiments were grown in Dulbecco’s modified Eagle’s medium DMEM supplemented with 10% fetal bovine serum and 50ug/ml normocin (ant-nr-2, Invivogen). HEK293 cells and other cell lines used were grown at 37°C and 5% CO2.
-
bioRxiv - Microbiology 2021Quote: BALB/c mice were immunized with 10 µg of SARS-CoV-2 RBD adjuvanted with 50% AddaVax™ (InvivoGen), via intramuscular route (i.m.) ...
-
bioRxiv - Bioengineering 2021Quote: ... of SARS-CoV-2 spike protein (NCBI Accession: YP 009724390.1) were synthesized and cloned into the pFUSE expression vector (InvivoGen). Both constructs contained an AVI-tag and a 6xHis tag at the C-terminus separated by a single G4S linker ...
-
bioRxiv - Immunology 2022Quote: ... CASP8-/- × MLKL-/- and subsequently derived gene-deficient BLaER1 macrophages were stimulated with 2 ng/mL LPS from E.coli (Invivogen) for 18 h ...
-
bioRxiv - Immunology 2023Quote: ... Dried lipid film was resuspended in 500 μL of buffer containing 25 mM Tris-HCl (pH 8.0) - 150 mM NaCl (Lp buffer) and 2 µg of recombinant human mIL-1β (Invivogen) or 10 µg of LDH (Sigma) ...
-
bioRxiv - Immunology 2023Quote: Cells were primed with 2 µg/mL (human primary Mo) or 10 µg/mL (BLaER1 Mo) of Pam3CSK4 (Invivogen) for 2 h before activation ...
-
bioRxiv - Immunology 2023Quote: ... of filtered PAO1 supernatant or TSB and KGMTM-2 containing purified flagellin at 1μg/ml or vehicle (tlrl-pafla; from P. aeruginosa; InvivoGen) were used for treating hTCEpi cells for various durations as indicated in the figure legends.
-
bioRxiv - Molecular Biology 2019Quote: ... livers of 10-week-old male or female mice were harvested 6 hours after tail-vein injection of LPS (2 mg/kg, Invivogen) or vehicle (PBS).
-
bioRxiv - Microbiology 2020Quote: ... A total of five adjuvants were tested for their efficacy within the vaccine formulations: Aluminum hydroxide gel (alum) (Alhydrogel adjuvant 2%, InvivoGen), Polyinosinic-polycytidylic acid (poly (I:C ...
-
bioRxiv - Cancer Biology 2021Quote: We transduced cells with lentivirus carrying KRAB-dCas9 and sgRNA targeting candidate progrowth enhancers and performed puromycin (2 μg/ml) (InvivoGen) for three days postelectroporation to select against non-transduced cells ...
-
bioRxiv - Immunology 2022Quote: ... cDNA encoding His-tagged Spike and RBD variants of SARS-CoV-2 were sub-cloned into pFUSE2ss-CLIg-hk (InvivoGen). The vectors were transfected as described for above the ACE2-albumin fusion protein and secreted His-tagged proteins were purified on HisTrap™ HP 1 mL columns (Cytiva) ...
-
bioRxiv - Cell Biology 2022Quote: ... U2OS media was replaced with fresh media and 24 hours later U2OS infected cells were selected with 2 µg/ml of puromycin (InvivoGen) for 72 hours.
-
bioRxiv - Neuroscience 2021Quote: ... were a kind gift of David Pla-Martin and Francesc Palau 21 and were grown in growth medium containing 2 μg/ml puromycin (InvivoGen).
-
bioRxiv - Immunology 2021Quote: ... by staining and acquiring control samples consisting of aliquots of fixed and frozen blood leukocytes from a healthy macaque after ex vivo stimulation of whole blood for 2 hours with three TLR ligands: LPS (LPS E. coli 0111: B4, Invivogen) at 1 μg/mL ...