Labshake search
Citations for Invivogen :
1101 - 1150 of 1525 citations for 7 7 4 4 Bipiperidine 1 1 diyldi 2 1 ethanediyl bis 10 methoxy 7H pyrido 4 3 c carbazole tetramethanesulfonate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... selecting with 10 μg/ml blasticidin (InvivoGen) and 2 μg/ml puromycin (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... and puromycin at 10 µg/ml (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... and 10 µg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 μg/mL blasticidin (Invivogen) to maintain TMPRSS2 expression ...
-
bioRxiv - Immunology 2020Quote: ... CpG2006 (TLR9; tlrl-2006; Invivogen, 10 μM), Flagellin (TLR5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... LPS (10 μg/mL, InvivoGen tlrl-eblps), ssDNA (1 μg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... or blasticidin (InvivoGen, 5 ∼ 10 µg/ml), as appropriate.
-
bioRxiv - Immunology 2022Quote: ... and 10 µg/mL of blasticidin (InvivoGen). MDBK-t2 cells were seeded into 24-well plates at 1 × 105 / well and incubated at 37°C in a 5% CO2 incubator overnight ...
-
bioRxiv - Immunology 2022Quote: ... OVA + CpG (10 μg, Invivogen, Cat# ODN1826) and OVA + Alum (200 μg Sigma ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 5-10 μg/ml blasticidin S (Invivogen) or FACS ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 μg saponin (InvivoGen, vac-quil) in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... infected cells were selected with medium containing 3 μg/ml puromycin medium (Invivogen, CA) for 4 days and resulting heterogenous pools were used for functional assays ...
-
bioRxiv - Biophysics 2023Quote: ... MEFs stably expressing Skylan-NS–LC3B were selected with 3 µg/mL puromycin (Invivogen), seeded on a glass slide coated with 0.3 mg/ml collagen (Nitta Gelatin ...
-
bioRxiv - Biophysics 2023Quote: ... Cell culture media was supplemented with 3 µg/ml puromycin (InvivoGen, San Diego, USA). As a control ...
-
bioRxiv - Molecular Biology 2020Quote: ... Puromycin (InVivoGen, Cat#ant-pr; CAS: 58-58-2) was added in the culture medium (1µM ...
-
bioRxiv - Biochemistry 2019Quote: ... followed by selection with puromycin (2 μg/ml; Invivogen). Doubly-transduced cells were subsequently cultured for two weeks to allow editing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were selected by puromycin (2 μg/ml) (InvivoGen) 3 days postelectroporation ...
-
bioRxiv - Microbiology 2021Quote: ... or Polyriboinosinic:polyribocytidylic acid (Poly I:C; 2 mg/mL) (InvivoGen) via intraperitoneal injection (200 μL per mouse ...
-
bioRxiv - Immunology 2020Quote: ... Pam3CSK4 (TLR1/2; tlrl-pms; Invivogen, 200 ng/ml), Poly (I:C ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 ug/ml Primocin (Invivogen, Cat# ant-pm-2), 10 mM nicotinamide (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 35% BSA and 2 ug/mL Plasmocin (InvivoGen, USA). Cells were cultivated for 30 days under the described conditions before passaging as single cells to specific experiments.
-
bioRxiv - Neuroscience 2019Quote: ... and 100 µg / ml Primocin (Invivogen, #ant-pm-2). Biopsy pieces were rinsed with EtOH (70% ...
-
bioRxiv - Bioengineering 2020Quote: ... supplemented with the antibiotic primocin (Invivogen, ant-pm-2) in a concentration of 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were selected using 2 μg/mL puromycin (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... 2 μg/ml of C3-YSD (InvivoGen, tlrl-ydnac), or 25 pmol of ISD (IDT ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 μg/ml Primocin (Invivogen, Cat#ant-pm-2), and 10 μM Y27632 (AbMole ...
-
bioRxiv - Immunology 2022Quote: ... and 50mg/ml Normocin (InvivoGen cat. # ant-nr-2).
-
bioRxiv - Genetics 2023Quote: ... with 100 μg/ml primocin (Invivogen, ant-pm-2), 10% BIT 9500 (Stemcell Technologies 09500) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 50 μg/ml Primocin (InvivoGen #ant-pm-2). For culturing human ASPCs ...
-
bioRxiv - Systems Biology 2024Quote: ... and antibiotic Normocin (Invivogen; Cat. No. Ant-nr-2) was replenished every day until 50% confluent26 ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 100µg/mL Normocin (InvivoGen #ant-nr-2). Glial cells were recovered and propagated for 7 days ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Primocin (100 μg/ml, InvivoGen, ant-pm-2). WENR is ENR medium supplemented with 5 nM Wnt-surrogate (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... and alhydrogel adjuvant 2% (alum, InvivoGen, vac-alu-250)) or alhydrogel adjuvant alone in a ratio of 1:1 (v/v) ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2024Quote: ... wildtype C57BL/6 were immunized by intraperitoneal injection of 5 µg Spike protein (5 µg, Bio-Techne) in presence of 10 µg CpG adjuvant (10 µg, ODN1826, Invivogen), followed by two reimmunization steps of 5 µg Spike protein in 10 µg CpG adjuvant every 15 days for a total of three immunizations.
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2019Quote: ... PAM3CSK4 (10 ng/ml, InvivoGen, San Diego, CA), (6 ...
-
bioRxiv - Neuroscience 2019Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Cell lysis and RNA extraction were performed 24h post-activation using Nucleospin RNA extraction kit (Macherey-Nagel) ...
-
bioRxiv - Physiology 2019Quote: ... or the PI3K inhibitor wortmannin (10 μM; InvivoGen) to inhibit Akt activation for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...