Labshake search
Citations for Invivogen :
951 - 1000 of 2005 citations for Testosterone 100 Ug Ml In Methylene Chloride 3 4 13C2 99%; 17 18O 98% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... selection for transduced cells was commenced by addition of 2.0 μg/ml puromycin or 300 μg/ml G418 (InvivoGen) or 8.0 μg/ml blasticidin (InvivoGen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were seeded in a 96 well dish at 1.4×105 cells/mL (HEK-hTLR4) and 2.8×105 cells/mL (HEK-null2) in HEK detection media (Cat# hb-det3 Invivogen) as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... LPS-EK (1 μg/mL) and ODN2006 (10 μg/mL) were purchased from InvivoGen (tlrl-kit1hw and tlrl-pslta). Calf thymus DNA was purchased from Sigma (D1501) ...
-
bioRxiv - Biochemistry 2022Quote: ... DOX-inducible cell lines generated in the parental TetOn-HeLa cell line were supplemented with 500 μg/mL G418 + 0.5 μg/mL puromycin (Invivogen).
-
bioRxiv - Pathology 2019Quote: Spleen B cells were isolated and stimulated in vitro (1×106 cell/mL) with 1µg/mL of LPS (InVivoGen) for four days ...
-
bioRxiv - Immunology 2021Quote: Enriched human memory B cells were cultured at 0.2 x 106 cells per ml in complete RPMI supplemented with 1 mg/ml R848 (Invivogen), 1 mg/ml soluble CD40L (Fitzgerald) ...
-
bioRxiv - Systems Biology 2022Quote: ... Five million spleen cells per condition were suspended at 1×106/ml in 10-ml Petri dishes pre-coated with 100 μg anti-CD3/CD28 or in culture medium supplemented or not with either LPS (1 μg/ml) or Poly (I:C) (both high and low molecular weight, 10 μg/mL each) (Invivogen). After 2 hours ...
-
bioRxiv - Immunology 2023Quote: Cells were primed with 2 µg/mL (human primary Mo) or 10 µg/mL (BLaER1 Mo) of Pam3CSK4 (Invivogen) for 2 h before activation ...
-
bioRxiv - Biochemistry 2023Quote: ... and 50 µL of the working solution of the QUANTI1Luc 4 Lucia/Gaussia reagent (Invivogen) was added ...
-
bioRxiv - Immunology 2019Quote: ... BMDMs from WT or Tlr2-/-mice were stimulated by rCsHscB (20 μg/ml) or Pam3CSK4 (200 ng/ml) (Invivogen, US) and supernatants were used for ELISA.
-
bioRxiv - Microbiology 2022Quote: ... the medium was further supplemented with puromycin (7 μg/ml for selection of clones or 6 μg/ml for maintenance of cell lines; Invivogen) and/or hygromycin (100 μg/ml for selection of clones or 70 μg/ml for maintenance of clones ...
-
bioRxiv - Genetics 2019Quote: ... The untransduced cells and serially diluted virus-treated cells were cultured in the presence of 2 μg/ml puromycin or 20 μg/ml blasticidin S (InvivoGen). When almost all of the untransduced cells had died ...
-
bioRxiv - Immunology 2019Quote: moDCs and THP-1 cells were left unstimulated or stimulated with 10 µg/ml MDP or 1 µg/ml PAM3CSK4 (Invivogen) or both at the indicated time points ...
-
bioRxiv - Microbiology 2020Quote: ... were primed with LPS (10ng/ml for PBMCs and monocytes, 100ng/ml for monocyte-derived macrophages and monocyte-derived DCs, Invivogen) for 3 hr and then stimulated with heat-killed T ...
-
bioRxiv - Immunology 2021Quote: Primary human monocyte derived macrophages (hMDMs) or murine bone marrow-derived macrophages (BMDMs) were primed with 1 μg/mL or 400 ng/mL Pam3CSK4 (InvivoGen), respectively for 4 h ...
-
bioRxiv - Immunology 2020Quote: Total spleen cells were cultured at a density of 1 × 106 cells/mL in RPMI 1640 supplemented with 10% fetal calf serum (FCS) with 5 ng/mL LPS (Invivogen). For 4-hydroxytamoxifen (OHTAM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lines used for all mturboID-MS experiments were generated in HEK293 Flp-InTM T-RExTM cells as previously described14 and pool of stable transfectants selected with 200 μg/mL hygromycin (Multicell) and 5 μg/mL blasticidin (Invivogen). Expression of bait proteins were induced with 1 μg/mL tetracycline for 24 h ...
-
bioRxiv - Cell Biology 2022Quote: ... and pKANA2CENPB followed by selection on hygromycin B (1 mg/mL, #089-06151, Wako) and blasticidin S (5 µg/mL, #ant-bl-05, InvivoGen).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 U/ml penicillin and 100 µg/ml streptomycin (MultiCell, Wisent) and in the presence of hygromycin B (200 µg/ml, MultiCell, Wisent) and blasticidin (10 µg/ml, InVivoGen) at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... After 48-72h the medium containing viruses was replaced with fresh media with 1 μg/mL Puromycin or 1 μg/mL Hygromycin B Gold (InvivoGen), used for selection.
-
bioRxiv - Genomics 2023Quote: ... Cells were then imaged in the imaging buffer (0.5 μg/ml DAPI, 10 μg/ml Fungin (InvivoGen ant-fn-1) in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... Cells transduced with lentiviruses encoding for the different gRNAs were passaged in selection medium containing 10 µg/ml blasticidin and 5 µg/ml puromycin (ant-pr-1, InvivoGen) to obtain polyclonal cell populations lacking either GSDMD or GSDME ...
-
bioRxiv - Immunology 2019Quote: ... the same amount of Amlexanox was injected again intraperitoneally with 100 μg MDP (Invivogen) and 10ug of PAM3CSK4 ...
-
bioRxiv - Bioengineering 2023Quote: ... vaccines also contain an adjuvant of CpG1826/Alum (20 μg + 100 μg, respectfully, Invivogen), SNP ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were routinely tested for mycoplasma detection with the kit (rep-mysnc-100, Invivogen).
-
bioRxiv - Biophysics 2023Quote: ... USA) in mTeSRTM Plus Basal Medium (Cat. No.100-11300) + Primocin (Cat. No.NC9392943, Invivogen). 3 x 105 cells/cm2 cells were seeded per well of a 6-well tissue culture plate ...
-
bioRxiv - Cancer Biology 2021Quote: ... or 5 μg/ml poly(I:C) HMW (InvivoGen). Two hours after induction cell viability was measured with alamarBlue ...
-
bioRxiv - Neuroscience 2021Quote: ... Puromycin (Invivogen 10 mg/ml, ant-pr-1) selection with 0.2 µg/ml in E8 medium started two days after transfection ...
-
bioRxiv - Immunology 2021Quote: ... 0.6 mg/ml monosodium urate crystals (MSU) (InvivoGen) for 6 h ...
-
bioRxiv - Immunology 2021Quote: ... 10ng/ml Pam3CSK4 (InvivoGen, Cat. no.# tlrl-pms.), 100ng/ml Poly I:C (InvivoGen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 15 µg/mL blasticidin (InvivoGen, ant-bl-1) at 37 °C in a humidified 5% CO atmosphere ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5μg/mL puromycin (InvivoGen, ant-pr-1). Beginning at day 7 ...
-
bioRxiv - Immunology 2021Quote: ... R-848 (1 µg/ml, tlrl-r848; InvivoGen), CpG ODN 1826 (1 µg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2.5 mg/mL Plasmocin (InvivoGen, Cat ant-mpp). All cells were tested for mycoplasma contamination.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Selection antibiotics were 80µg mL−1 Zeocin (Invivogen) for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were grown in 5µg/ml Hygromycin (Invivogen). PF cells were transfected using the same procedure ...
-
bioRxiv - Molecular Biology 2019Quote: ... Puromycin (conc. 1µg/mL, #ant-pr-1, Invivogen) and blasticidin (conc ...
-
bioRxiv - Immunology 2021Quote: ... or 10mg/ml PI3 Kinase inhibitor (LY294002, Invivogen) as controls ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mg/ml Primocin (InvivoGen, #ant-pm-0.5), 1X B-27 supplement (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: ... mixed with 0.5 ml alum adjuvant (Alhydrogel, Invivogen) for each animal ...
-
bioRxiv - Cancer Biology 2021Quote: ... then treated with 1 μg/mL LPS (Invivogen) for 90 minutes.
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Microbiology 2021Quote: ... 0.5 μg/ml puromycin (Invivogen, ant-pr-1) and 100 μg/ml zeocin (Invivogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μg/mL Primocin (Invivogen ant-pm-05), 3 μM SB202190 (Peprotech 1523072) ...
-
bioRxiv - Cancer Biology 2021Quote: ... We started puromycin selection (2 μg/ml) (InvivoGen) 48 hours post-transduction for at least two days or until no survival cell was observed from the control group ...
-
bioRxiv - Neuroscience 2022Quote: ... and normocin (50mg/ml) (ant-nr-1, InvivoGen) in 5% CO2 humidified atmosphere at 37 0C.
-
bioRxiv - Genetics 2022Quote: ... at 1μg/mL or blasticidin (Invivogen, ant-bl) at 5μg/mL).
-
bioRxiv - Immunology 2022Quote: ... 1 - 2 μg ml-1 poly(dA:dT) (InvivoGen) (transfected with Lipofectamine 2000 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 µg/mL hygromycin (InvivoGen, San Diego, CA) or 100 µg/mL nourseothricin (Gold Biotechnology ...