Labshake search
Citations for Invivogen :
51 - 100 of 551 citations for Cow Putative Phospholipase B Like 2 PLBD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... and selected with 100 μg/ml Hygromycin B (Invivogen) and 10 μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Immunology 2021Quote: ... Class B (murine) (TLR9 agonist) were purchased from InvivoGen. PIKA ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Molecular Biology 2019Quote: ... plates included 200 µg/mL Hygromycin B Gold (InvivoGen) or 133 µg/mL Nourseothricin (Gold Biotechnology) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200μg/mL Hygromycin B Gold (Invivogen, #ant-hg) until they form colonies for ten to fourteen days ...
-
bioRxiv - Bioengineering 2022Quote: ... (3) LPS and 150 μg/ml Polymyxin B (Invivogen) for 45 and 90 min ...
-
bioRxiv - Immunology 2023Quote: ... 10% FCS and 250µg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions using DMEM medium supplemented with glutamax and 2% FCS ...
-
bioRxiv - Microbiology 2023Quote: ... selection was performed using 200μg/ml hygromycin B (InvivoGen) until only GFP positive cells remained ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5 mg/mL Hygromycin B (InvivoGen, San Diego, USA) to the complete DMEM (Miyoshi and Stappenbeck ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100ug/mL Hygromycin B Gold (Invivogen, #ant-hg-1). Blast+/Hygro+ cells were then clonally sorted via FACS as described in the previous section to obtain a uniform population for experiments ...
-
bioRxiv - Immunology 2021Quote: ... Type B CPG ODN 2006 and R848 were from Invivogen. Antibodies anti-NF-κB p65 (D14E12) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 μg/ml hygromycin B Gold (InvivoGen, ant-hg) to maintain the properties of the po- or c-DD-DAO Flp-In T-REx 293 stable cell lines ...
-
bioRxiv - Molecular Biology 2020Quote: ... to which 100 μg/mL of Hygromycin B Gold (Invivogen) was added for selection ...
-
bioRxiv - Immunology 2020Quote: ... B cells were stimulated with CpG ODN 1826 (1μM, Invivogen) in the presence of IL-2 (25U/ml ...
-
bioRxiv - Immunology 2023Quote: ... cells were stimulated with either 1µg/ml CpG B (Invivogen) or left unstimulated in complete media (RPMI1640 ...
-
Increased dosage of wild-type KRAS protein drives KRAS-mutant lung tumorigenesis and drug resistancebioRxiv - Cancer Biology 2024Quote: ... or hygromycin B for 7 days (500 µg/ml, InvivoGen). Cells were transfected using GeneJuice (Merck ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen) for transfected cells.
-
bioRxiv - Cancer Biology 2021Quote: ... and were selected with 400 µg/ml hygromycin B GoldTM (Invivogen). Recombinant His-tagged proteins were purified from cell lysates on a nickel-chelating column (Ni-nitrilotriacetic acid agarose ...
-
bioRxiv - Immunology 2022Quote: ... and Type B CpG OND D-SL01 (InvivoGen, San Diego, USA). After 5 days of in vitro culture ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were selected using 100 μg/ml Hygromycin B gold (InvivoGen). All stable cell lines were always kept under selection.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were selected using 100 μg/mL Hygromycin B gold (InVivoGen). For creation of the BioID2-APC2 and APC3-BioID2 cell lines the same protocol was performed ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200 μg/ml Hygromycin B (HYGR) gold (Invivogen, #ant-hg). The (AID-EWSR1/AID-EWSR1 ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2023Quote: ... 50 µg synthetic Class B CpG oligonucleotide (ODN1826) (vac-1826; Invivogen), or unadjuvanted ...
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 µg/ml Hygromycin B Gold (InvivoGen, #ant-hg-1) was routinely used ...
-
bioRxiv - Neuroscience 2024Quote: ... cocultures were pre-treated with Leptomycin B (LMB, 50 nM, Invivogen) or GppNHp (non-hydrolyzable GTP analogue ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were selected by 200 µg/ml hygromycin B (Invivogen) for 7 days ...
-
bioRxiv - Immunology 2022Quote: ... Culture supernatants were harvested and analyzed for IFNγ induction using via IFNγ ELISA (InvivoGen). For some experiments ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were selected with 250 mg/ml hygromycin B Gold (InvivoGen) for 2 weeks ...
-
bioRxiv - Molecular Biology 2021Quote: ... or hygromycin B Gold (200 µg/ml, InvivoGen, Cat#: ant-hg-1) depending on expressed marker genes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μg/ml hygromycin B (Calbio-chem. 10 μg/ml blasticidin (InvivoGen). Independent clones were obtained by serial dilution.
-
bioRxiv - Immunology 2020Quote: ... B cells were activated with TLR9 ligand CpG ODN 2006 (1μM, Invivogen), alongside IL-2 (25U/ml ...
-
bioRxiv - Microbiology 2022Quote: ... The parasites were selected with 5 μg/mL hygromycin B Gold (Invivogen). Overexpression was induced with 1 μg/ml tetracycline (Sigma-Aldrich).
-
bioRxiv - Immunology 2023Quote: ... Type I IFN secretion was detected Hek-Blue IFNa/b Cells (Invivogen). Briefly ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and selected with 40 μg/ml hygromycin B (InvivoGen, San Diego, CA). Empty vector-transfected (EV ...
-
bioRxiv - Cancer Biology 2021Quote: ... 100 μg/ml Hygromycin B and 50 μg/ml Zeocin (all from InvivoGen). Primary human bone marrow-derived mesenchymal stem cells were obtained from ATCC (PCS-500-012) ...
-
bioRxiv - Cell Biology 2022Quote: ... with 10% fetal bovine serum (FBS) and 10 µg/mL Hygromycin B (InvivoGen) at 37°C in 5% CO2 ...
-
bioRxiv - Genomics 2021Quote: Hygromycin B Gold (100 mg/mL) was ordered from Invivogen (ant-hg-1). Selection was done with 450µg/mL hygromycin.
-
bioRxiv - Immunology 2021Quote: ... The positive clones (iR9X2-ESC) selected by hygromycin B (150 μg/ mL, Invivogen) were further cultured in ES medium supplemented with doxycycline (1 μg/mL ...
-
bioRxiv - Immunology 2022Quote: ... LPS-stimulated B cells were treated with 100 nM of Bafilomycin A1 (InvivoGen) for 3 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... 15 μg/ml G418 or the indicated amount of Hygromycin B Gold (InvivoGen) was added for selection ...
-
bioRxiv - Immunology 2023Quote: ... The Class B CpG ODN2006 (ODN 7909, PF_3512676, sequence: 5’-tcgtcgttttgtcgttttgtcgtt-3’, Invivogen) was diluted in sterile endotoxin-free water ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...