Labshake search
Citations for Invivogen :
51 - 100 of 540 citations for 7 Chloro 1H pyrrolo 3 2 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... providing an additional metric for assessing cell health post-drug treatment for both 2’-3’cGAMP (Invivogen) and Sulfasalazine (Cayman Chemical).
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 3′3′-cGAMP (100 μM; InvivoGen), c-di-AMP (100 µM ...
-
bioRxiv - Plant Biology 2021Quote: ... Transgenic Col-0 (LUC) plants were selected on 1/2 MS medium supplemented with 50 μM hygromycin B (InvivoGen, Cat No. ant-hg-5). LUC activity was confirmed as described above ...
-
bioRxiv - Immunology 2022Quote: ... we read the plate on Cytation 7 (Cytation 7, Bio-Tek Instruments, Inc.) after adding 50 μL QUANTI-Luc™ (Invivogen) substrate solution per well ...
-
bioRxiv - Immunology 2022Quote: ... we read the plate on Cytation 7 (Cytation 7, Bio-Tek Instruments, Inc.) after adding 50 μL QUANTI-Luc™ (InvivoGen) substrate solution per well ...
-
bioRxiv - Cell Biology 2021Quote: ... selected with 180 µg/ml hygromycin B (Invivogen). Stable clonal cell lines were isolated by dilution into 96 well plates from the pooled stable cell lines.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were selected with Hygromycin B (Invivogen) 200 μg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Immunology 2021Quote: ... P1 and B.1.429 were purchased from InvivoGen while others were made by us or collaborators ...
-
bioRxiv - Genomics 2022Quote: ... 150 ug/mL hygromycin B Gold (Invivogen # ANTHG1) was added for TOP2A-Venus selection ...
-
bioRxiv - Microbiology 2022Quote: ... pH5.5) supplemented with 70μg/ml hygromycin B (InvivoGen) or 70μg/ml nourseothricin (ClonNAT ...
-
bioRxiv - Immunology 2023Quote: ... and Delta (B.1.617.2) (InvivoGen, plv-spike-v8). Plasmids encoding the S protein from the Omicron variants (B.1.1.529 and BA.2 ...
-
bioRxiv - Immunology 2022Quote: ... and selected with 200μg/mL Hygromycin B (Invivogen) two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... and 100 µg/ml of hygromycin B (Invivogen). Expression of NS4B-APEX protein was induced by incubating the cells with 1 ng/ml of doxycycline (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1), B-27 (ThermoFisher #17504044 ...
-
bioRxiv - Microbiology 2021Quote: ... were immunized with 3 ugs of purified RBD of SARS-CoV-2 mixed with 10 ugs of poly I:C (Invivogen) twice with 3 weeks interval (17 ...
-
bioRxiv - Cell Biology 2020Quote: ... and selected with 100 μg/ml Hygromycin B (Invivogen) and 10 μg/ml Blasticidin (Invivogen) ...
-
bioRxiv - Immunology 2021Quote: ... 10% FBS and 250μg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions by the NIAID SARS-CoV-2 Virology Core using DMEM medium supplemented with glutamax and 2% FBS ...
-
bioRxiv - Immunology 2021Quote: ... Class B (murine) (TLR9 agonist) were purchased from InvivoGen. PIKA ...
-
bioRxiv - Microbiology 2022Quote: ... 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1), and 100 μg/mL Zeocin (Invivogen #ant-zn-1).
-
bioRxiv - Molecular Biology 2019Quote: ... plates included 200 µg/mL Hygromycin B Gold (InvivoGen) or 133 µg/mL Nourseothricin (Gold Biotechnology) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200μg/mL Hygromycin B Gold (Invivogen, #ant-hg) until they form colonies for ten to fourteen days ...
-
bioRxiv - Immunology 2023Quote: ... 10% FCS and 250µg/ml Hygromycin B gold (InvivoGen). Virus stock production was performed under BSL-3 conditions using DMEM medium supplemented with glutamax and 2% FCS ...
-
bioRxiv - Microbiology 2023Quote: ... selection was performed using 200μg/ml hygromycin B (InvivoGen) until only GFP positive cells remained ...
-
bioRxiv - Immunology 2023Quote: ... the cells were pre-incubated with the respective antagonist as suggested by the manufacturer’s protocol (STING: H-151 for 1-2 hours and cGAS: RU.521 for 3 hours, both InvivoGen, USA) in cell growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... and 0.5 mg/mL Hygromycin B (InvivoGen, San Diego, USA) to the complete DMEM (Miyoshi and Stappenbeck ...
-
bioRxiv - Cell Biology 2022Quote: ... and 100ug/mL Hygromycin B Gold (Invivogen, #ant-hg-1). Blast+/Hygro+ cells were then clonally sorted via FACS as described in the previous section to obtain a uniform population for experiments ...
-
bioRxiv - Immunology 2021Quote: ... Type B CPG ODN 2006 and R848 were from Invivogen. Antibodies anti-NF-κB p65 (D14E12) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 μg/ml hygromycin B Gold (InvivoGen, ant-hg) to maintain the properties of the po- or c-DD-DAO Flp-In T-REx 293 stable cell lines ...
-
bioRxiv - Molecular Biology 2020Quote: ... to which 100 μg/mL of Hygromycin B Gold (Invivogen) was added for selection ...
-
bioRxiv - Immunology 2020Quote: ... B cells were stimulated with CpG ODN 1826 (1μM, Invivogen) in the presence of IL-2 (25U/ml ...
-
bioRxiv - Immunology 2023Quote: ... cells were stimulated with either 1µg/ml CpG B (Invivogen) or left unstimulated in complete media (RPMI1640 ...
-
bioRxiv - Cell Biology 2022Quote: ... 3- methyladenine (Invivogen), bafilomycin A1 (Invivogen) ...
-
bioRxiv - Microbiology 2021Quote: ... 6-7 week-old BALB/c mice were ordered from Invivogen/Envigo and were allowed to acclimatize for 10 days prior to experimentation ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen) for transfected cells.
-
bioRxiv - Cancer Biology 2021Quote: ... and were selected with 400 µg/ml hygromycin B GoldTM (Invivogen). Recombinant His-tagged proteins were purified from cell lysates on a nickel-chelating column (Ni-nitrilotriacetic acid agarose ...
-
bioRxiv - Immunology 2022Quote: ... and Type B CpG OND D-SL01 (InvivoGen, San Diego, USA). After 5 days of in vitro culture ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were selected using 100 μg/ml Hygromycin B gold (InvivoGen). All stable cell lines were always kept under selection.
-
bioRxiv - Cell Biology 2020Quote: ... Cells were selected using 100 μg/mL Hygromycin B gold (InVivoGen). For creation of the BioID2-APC2 and APC3-BioID2 cell lines the same protocol was performed ...
-
bioRxiv - Cell Biology 2022Quote: ... and 200 μg/ml Hygromycin B (HYGR) gold (Invivogen, #ant-hg). The (AID-EWSR1/AID-EWSR1 ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2023Quote: ... 50 µg synthetic Class B CpG oligonucleotide (ODN1826) (vac-1826; Invivogen), or unadjuvanted ...
-
bioRxiv - Immunology 2023Quote: ... or 1 μM 6-formylindolo[3,2-b]carbazole (FICZ [84], Invivogen). Cytokine blockade was achieved using IL-1 receptor A antagonist anakinra (10 μg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 µg/ml Hygromycin B Gold (InvivoGen, #ant-hg-1) was routinely used ...
-
bioRxiv - Neuroscience 2024Quote: ... cocultures were pre-treated with Leptomycin B (LMB, 50 nM, Invivogen) or GppNHp (non-hydrolyzable GTP analogue ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were selected by 200 µg/ml hygromycin B (Invivogen) for 7 days ...
-
bioRxiv - Cell Biology 2022Quote: ... the cationic lipid-based transfection reagent LyoVec and cyclic [G(2’,5’)pA(3’,5’)p] (2’3’-cGAMP) were obtained from Invivogen (San Diego, USA) and Lipofectamine2000 was obtained from ThermoFisher Scientific (Dreieich ...