Labshake search
Citations for Invivogen :
851 - 900 of 1967 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Molecular Biology 2021Quote: ... 15 µg/mL blasticidin (InvivoGen, ant-bl-1) at 37 °C in a humidified 5% CO atmosphere ...
-
bioRxiv - Immunology 2022Quote: ... 100 µg/mL Primocin (InvivoGen, ant-pm-1), 1.25 mM N-Acetyl-L-cysteine (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5μg/mL puromycin (InvivoGen, ant-pr-1). Beginning at day 7 ...
-
bioRxiv - Immunology 2022Quote: ... and 100 μg/ml of Zeocin™ (Invivogen). GHOST cells stably expressing CD4 ...
-
bioRxiv - Immunology 2021Quote: ... R-848 (1 µg/ml, tlrl-r848; InvivoGen), CpG ODN 1826 (1 µg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2.5 mg/mL Plasmocin (InvivoGen, Cat ant-mpp). All cells were tested for mycoplasma contamination.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Selection antibiotics were 80µg mL−1 Zeocin (Invivogen) for AtT20-WT or 80µg mL−1 hygromycin B Gold (Invivogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were grown in 5µg/ml Hygromycin (Invivogen). PF cells were transfected using the same procedure ...
-
bioRxiv - Molecular Biology 2019Quote: ... Puromycin (conc. 1µg/mL, #ant-pr-1, Invivogen) and blasticidin (conc ...
-
bioRxiv - Immunology 2021Quote: ... or 10mg/ml PI3 Kinase inhibitor (LY294002, Invivogen) as controls ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1 mg/ml Primocin (InvivoGen, #ant-pm-0.5), 1X B-27 supplement (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... and 100 μg/mL Primocin (Invivogen, Toulouse, France) before adding the cells to the culture plates.
-
bioRxiv - Bioengineering 2020Quote: ... mixed with 0.5 ml alum adjuvant (Alhydrogel, Invivogen) for each animal ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 μg/ml Primocin (Invivogen ant-pm-1)) plus 10 uM Y-27632 (Sigma Aldrich Y0503 ...
-
bioRxiv - Cancer Biology 2021Quote: ... then treated with 1 μg/mL LPS (Invivogen) for 90 minutes.
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μg/ml hygromycin (Invivogen, ant-hg-1), 0.5 μg/ml puromycin (Invivogen ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 μg/ml puromycin (Invivogen, ant-pr-1) and 100 μg/ml zeocin (Invivogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μg/mL Primocin (Invivogen ant-pm-05), 3 μM SB202190 (Peprotech 1523072) ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 µg/mL normocin (InvivoGen# ant-nr-1). Thirty µL of 5 x10E5 THP-1 cells/ml were seeded per well of a 384-well plate and incubated at 37°C 5%CO2 for 24h ...
-
bioRxiv - Cancer Biology 2021Quote: ... We started puromycin selection (2 μg/ml) (InvivoGen) 48 hours post-transduction for at least two days or until no survival cell was observed from the control group ...
-
bioRxiv - Neuroscience 2022Quote: ... and normocin (50mg/ml) (ant-nr-1, InvivoGen) in 5% CO2 humidified atmosphere at 37 0C.
-
bioRxiv - Genetics 2022Quote: ... at 1μg/mL or blasticidin (Invivogen, ant-bl) at 5μg/mL).
-
bioRxiv - Cancer Biology 2022Quote: ... as well as 100 μg/ml Primocin (Invivogen). Cell lines were regularly checked for mycoplasma infections by Mycoplasma PCR-detection test (Thermo-Fisher).
-
bioRxiv - Immunology 2022Quote: ... 1 - 2 μg ml-1 poly(dA:dT) (InvivoGen) (transfected with Lipofectamine 2000 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 50 µg/mL hygromycin (InvivoGen, San Diego, CA) or 100 µg/mL nourseothricin (Gold Biotechnology ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5 µg/mL Puromycin (Invivogen #ant-pr-1), 200 μg/mL Hygromycin-B (Invivogen #ant-hg-1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... or 6 µg/mL of blasticidine S (InvivoGen) for 10 days ...
-
bioRxiv - Cell Biology 2022Quote: ... After adding with 1 μg/ml ionomycin (InvivoGen) or thapsigargin (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 μg/mL Normocin (Invivogen #Ant-nr-1) at which time they were transfected with RNPs by electroporation and re-plated ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Poly(I:C)(1 mg/mL, Invivogen tlrl-pic), or control (filtered seawater) ...
-
bioRxiv - Cell Biology 2022Quote: ... and selection with puromycin (1 μg/ml, Invivogen). Cells were grown at 37°C and 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... antibiotics and 2.5 µg/ml of plasmocin (InvivoGen). UMSCC-47 cells (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Hygromycin B Gold (50 μg/ml, InvivoGen) as selection antibiotics ...
-
bioRxiv - Cell Biology 2020Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2019Quote: ... and treated with 200 μg/ml zeocin (InvivoGen) to select for stably transfected cells ...
-
bioRxiv - Cell Biology 2019Quote: ... 200μg/ml Hygromycin B Gold (#ant-hg, Invivogen)) ...
-
bioRxiv - Cell Biology 2020Quote: ... One replicate received 1 μg/mL puromycin (Invivogen). After 3 days ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 1 mg/mL Puromycin (InvivoGen, ant-pr) and incubated at 37 °C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100 μg/ml Zeocin (InvivoGen, ant-zn-5p) and 5 μg/ml Blasticidin (InvivoGen ...
-
bioRxiv - Microbiology 2020Quote: ... and 100 μg/ml of Zeocin™ (Invivogen).Caco-2 and Calu-3 cells were stimulated for 24 h with media containing TLR4 agonist Lipopolysaccharide (LPS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transduced PSCs were Puromycin selected (2μg/mL) (Invivogen) and differentiated into definitive endoderm (DE ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Systems Biology 2021Quote: ... 100 μg/ml primocin (ant-pm-1, InvivoGen), 100 ng/ml recombinant human FGF2 (100-18C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1.5 μg/ml puromycin (InvivoGen, San Diego, USA) was added to the medium to select for the Lhx2 expressing LSK cells ...
-
bioRxiv - Cell Biology 2021Quote: ... 500 μg/ml G418 (Invivogen #ant-gn-5) and 5 μg/ml puromycin (ThermoFisher Scientific #A1113803) ...
-
bioRxiv - Cell Biology 2020Quote: ... 10mg/mL blasticidin (Invivogen, San Diego, CA, USA), 50mg/mL hygromycin (Thermo) ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 µg/mL primocin (Invivogen, ant-pm-2), 20 µM floxuridine ...