Labshake search
Citations for Invivogen :
801 - 850 of 1918 citations for Trisodium dichloroanthra 2 1 9 mna naphth 2 3 h acridine 5 10 15 triyl tris sulfate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and puromycin at 10 µg/ml (InvivoGen).
-
bioRxiv - Immunology 2020Quote: ... and 10 µg monophosphoryl Lipid A (InVivogen) diluted in 1X Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 μg/mL blasticidin (Invivogen) to maintain TMPRSS2 expression ...
-
bioRxiv - Immunology 2020Quote: ... CpG2006 (TLR9; tlrl-2006; Invivogen, 10 μM), Flagellin (TLR5 ...
-
bioRxiv - Immunology 2023Quote: ... 10 µg/mL Ac-YVAD-cmk (Invivogen), 5 µg/mL RU.521 (Invivogen) ...
-
bioRxiv - Immunology 2022Quote: ... and 10 µg/mL of blasticidin (InvivoGen). MDBK-t2 cells were seeded into 24-well plates at 1 × 105 / well and incubated at 37°C in a 5% CO2 incubator overnight ...
-
bioRxiv - Immunology 2022Quote: ... OVA + CpG (10 μg, Invivogen, Cat# ODN1826) and OVA + Alum (200 μg Sigma ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 10 ug/mL blinatumomab (InVivoGen, # bimab-hcd19cd3) in PBS was added to CD19 probes for 1h ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 μg saponin (InvivoGen, vac-quil) in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... LPS (10 μg/mL, InvivoGen tlrl-eblps), ssDNA (1 μg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... and/or 10 μg/ml blasticidin (InvivoGen). Expression of double-stranded RNA was induced by adding 1 μg/ml tetracycline (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... VX-765 (Invivogen; final concentration 10 µM), was used as a positive control for inflammasome inhibition.
-
bioRxiv - Biochemistry 2024Quote: ... AddaVax (InvivoGen Cat t#vac-adx-10) was purchased as a 2x ready-to-use suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... PolyI:C (10 mg/mL, InvivoGen; tlrl-picw), FAS ligand (10 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µg/ml blasticidin (InvivoGen, ant-bl), or 800 µg/ml neomycin (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Matrigel/cell mix was incubated for 15 min at 37C to allow for solidification and base media with Primocin® (InvivoGen) was added to top and bottom chambers of transwell ...
-
bioRxiv - Cell Biology 2021Quote: ... infected cells were selected with medium containing 3 μg/ml puromycin medium (Invivogen, CA) for 4 days and resulting heterogenous pools were used for functional assays ...
-
bioRxiv - Biophysics 2023Quote: ... MEFs stably expressing Skylan-NS–LC3B were selected with 3 µg/mL puromycin (Invivogen), seeded on a glass slide coated with 0.3 mg/ml collagen (Nitta Gelatin ...
-
bioRxiv - Biophysics 2023Quote: ... Cell culture media was supplemented with 3 µg/ml puromycin (InvivoGen, San Diego, USA). As a control ...
-
bioRxiv - Immunology 2022Quote: ... or 72 h to induce macrophage polarization: (i) for M1 polarization with 100 ng/mL LPS (Ultrapure; InvivoGen, San Diego, CA) and 20 ng/mL IFNγ (R&D ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were treated for 6 h with the indicated concentration of either High Molecular Weight (HMW) Poly(I:C) (InvivoGen, tlrl-pic) or Poly(I:C ...
-
bioRxiv - Microbiology 2024Quote: 75,000 C57BL/6J BMDMs were seeded in a 96 well plate and treated for 24 h with 100 U/ml IFNγ and 0.2 µg/ml LPS (InvivoGen 0111:B4), or left untreated as control before infection with RH ΔUPRT ...
-
bioRxiv - Systems Biology 2023Quote: ... the cells were trypsinized and transferred to a 10 cm dish containing DMEM supplemented with 10% FBS and 200 µg/ml hygromycin B (Invivogen) for selection ...
-
bioRxiv - Immunology 2021Quote: ... at 5 μg/mL or the TLR4 agonist lipopolysaccharide (LPS; Invivogen) at 100 ng/mL or the TLR9 agonist class A CpG ODNs (CpG-A ...
-
bioRxiv - Immunology 2020Quote: ... and for TLR9 stimulation 5 µg/ml ODN1826 (tlrl-1826, InvivoGen). Unstimulated DC received no additives ...
-
bioRxiv - Neuroscience 2023Quote: ... with addition of 100 μg/mL G418 (Invivogen, #ant-gn-5) in case of GL261-tdTomato+Luc+ cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... or with 5 ug/ml OVA peptide (a.a.257-264, InvivoGen) for 4-5 hr in the presence of Golgi Stop (1/1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and selected with 5 μg/ml blasticidin (Invivogen, ant-bl-10p). Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... Recombined cells were selected with 5 μg/mL blasticidin S (InvivoGen) and 250 μg/mL hygromycin B (Roche Diagnostics ...
-
bioRxiv - Immunology 2023Quote: ... and RIG-I agonist (5’ triphosphate hairpin RNA, 3p-hpRNA, Invivogen). CHME-5xISRE-Nluc cells were maintained in DMEM supplemented with 10% FBS and pen/strep with 0.1 mg/ml hygromycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were selected under either 5 μg/ml Blasticidin-S (Invivogen) for two weeks or 5 μg/ml Puromycin (Invivogen ...
-
bioRxiv - Microbiology 2022Quote: ... Transfectants were selected with 5 μg/mL hygromycin B Gold (Invivogen). RNAi was induced with 1 μg/mL tetracycline (Sigma).
-
bioRxiv - Immunology 2022Quote: ... and stimulated with 2.5 μg/mL R848 (Invivogen, tlrl-r848-5) and 1,000 U/mL human recombinant IL-2 (ImmunoTools ...
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: ... Stable transfectants were selected with Blasticidin S (5 μg/mL, Invivogen), puromycin (1 μg/mL ...
-
bioRxiv - Immunology 2021Quote: ... or stimulated with 10 ug/ml Pam3CSK4 (Invivogen), 10 ng/mL LPS from Salmonella typhosa (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ug/mL flagellin from Salmonella typhimurium (Invivogen), 10 ug/mL lipoteichoic acid (LTA ...
-
bioRxiv - Immunology 2021Quote: ... 10 μg of OVA (Cat: VAC-POVA, Invivogen) and 8 μg of CpG (Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... After selection with 10 µg/mL blasticidin (Invivogen), a monoclonal cell line showing high CasRx expression after dox treatment was further transduced with SEDT2 gRNA#1 (AGATCCACAACAAAGACAGCCCA) ...
-
bioRxiv - Immunology 2020Quote: ... and 10 μg of ODN 1826 (CpG, Invivogen) resuspended in sterile phosphate buffered saline (PBS) ...
-
bioRxiv - Immunology 2020Quote: ... R837 (TLR7; tlrl-imqs; Invivogen, 10 μg/ml), and R848 (TLR7/8 ...
-
bioRxiv - Immunology 2020Quote: ... for 4 hours and 10 μM nigericin (InvivoGen) for an additional 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... mice were injected with 10 µg LPS (InvivoGen), 5 µg CGRP (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2021Quote: ... or 10 µg/mL blasticidin (InvivoGen; AX526 lentivirus).
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg/ml Blasticidin (InvivoGen; BLL-38-02A) were added to the medium of WI38 fast for sgRNA plasmid selection in cell cycle arrest treatment assay (Fig 5) ...
-
bioRxiv - Neuroscience 2021Quote: ... and ultra-pure LPS (10 ng/ml, InvivoGen). Purity after isolation was evaluated by FACS analysis with anti-CD14-FITC (Miltenyi) ...
-
bioRxiv - Immunology 2022Quote: HEK-BlueTM IL-10 (InvivoGen Cat#hkb-il10) and IFNγ (InvivoGen Cat#hkb-ifng ...
-
bioRxiv - Immunology 2023Quote: ... depleted zymosan (10 μg /mL, InvivoGen tlrl-zyd), Pam3CSK4 (100 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... or PHA (10 ug/mL, Invivogen, #inh-phap) were used ...
-
bioRxiv - Immunology 2022Quote: ... and 10 μg Quil-A (Invivogen, vac-quil) in PBS for a total volume of 250 μl for each mouse ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µmol Y-27632 Rock inhibitor (InvivoGen, USA), and 200 µg/ml Geneticin (Gibco ...