Labshake search
Citations for Invivogen :
601 - 650 of 1045 citations for Primary Human Coronary Artery Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the cells were further cultured in the medium containing 1μg/mL Blasticidin (Invivogen, #antbl) and 200μg/mL Hygromycin B Gold (Invivogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and THP1-Dual (IRF-responsive) cell lines were purchased from InvivoGen (San Diego, CA). HEK-Lucia RIGI and HEK-Dual TLR3 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retrovirally-infected cells were then selected with 10μg/mL blasticidin (Invivogen, ant-bl-1) for 5d prior to use for experimentation.
-
bioRxiv - Cell Biology 2022Quote: ... Transfected cells were selected with 600 µg/ml of G418 (Invivogen: ant-gn-5) in DMEM with 10% FCS and 100U/ml P/S followed by single cell cloning ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells expressing C3G-mEGFP or mEGFP were selected with 10 μg/ml blasticidin (InvivoGen) for 3 weeks ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were confirmed to be mycoplasma free using the MycoStrip test supplied by InvivoGen. Cell line authentication was confirmed by short tandem repeat genetic profiling carried out by Eurofins ...
-
bioRxiv - Microbiology 2023Quote: ... transfected cells were selected with 10 μg/ml of puromycin (Invivogen # ant-pr-1). After 48 h ...
-
bioRxiv - Immunology 2022Quote: ... before addition of SEAP reporter 293 cells expressing hACE2 (Invivogen, cat. code hkb-hace2). Cells were co-cultured for 24h and cell-cell fusion was assessed measuring secreted embryonic alkaline phosphatase (SEAP ...
-
bioRxiv - Microbiology 2023Quote: ... transduced cells were maintained for zeocin (50 μg/mL; Invivogen, Cat#ant-zn-1) selections for 14 days.
-
bioRxiv - Immunology 2023Quote: ... For mTORC1 activation cells were treated with 5nM Bafilomycin A1 (Invivogen Cat. tlrl-baf1). For inhibition of lysosomal proteases MutuDC1 cells pre-treated with 20μM leupeptin for 4h ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated with 500 ng/ml lipopolysaccharide (LPS) from Escherichia coli (InvivoGen) for 2 h to induce lysosome tubulation and then washed in PBS and imaged in DMEM medium live.
-
bioRxiv - Microbiology 2023Quote: ... cells were stimulated by transfection with 1 μg of poly(I:C) (tlrl-pic; Invivogen) for an additional 8 hours at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was added IL-1β Reporter HEK 293 Cells (Invivogen cat. hkb-il1bv2) following the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... Cell culture media was supplemented with 3 µg/ml puromycin (InvivoGen, San Diego, USA). As a control ...
-
bioRxiv - Cell Biology 2023Quote: ... stably transfected cells were selected with 1.5 µg/ml of puromycin (InvivoGen, ant-pr). Cells were maintained in the presence of puromycin and ready to be used ...
-
bioRxiv - Cell Biology 2023Quote: ... Transduced cells were selected with 10 μg/mL puromycin (InvivoGen, cat#ant-pr-1) or 10 μg/mL blasticidin (InvivoGen ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then split twice before selection was added: blasticidin (Invivogen, #ant-bl-1) to a final concentration of 10 µg/mL and Geneticin/G418 (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were routinely tested for mycoplasma detection with the kit (rep-mysnc-100, Invivogen).
-
bioRxiv - Biochemistry 2023Quote: ... the transduced cells were then selected in blasticidin (10 μg/mL, Invivogen, ant-bl) for 2 weeks ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were selected 24 hours after infection by adding puromycin (Invivogen ant-pr-1) at 2ug/mL concentration for a week ...
-
bioRxiv - Immunology 2023Quote: ... cells were selected via the addition of 3μg/mL puromycin (Invivogen, ant-pr-1). 96 hrs post-transduction ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected and maintained for 6 days with 750 ng/µl Zeocin (Invivogen) until harvest on day 7.
-
bioRxiv - Microbiology 2023Quote: ... Cell lines were confirmed to be mycoplasma-free using MycoStrip (InvivoGen, rep-mys-50). Primary human small airway epithelial cells (HSAEC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transduced cells were selected using 1 μg/mL puromycin (InvivoGen, cat. ant-pr-1).
-
bioRxiv - Bioengineering 2024Quote: CD20+ Raji cells were pre-treated with anti-hCD20 mAb (InvivoGen, San Diego, CA) at 10 μg/mL for 30 min at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... the supernatants of the cells were incubated with QUANTI-Blue (InvivoGen, catalog # rep-qbs) for 1–6 h ...
-
bioRxiv - Immunology 2023Quote: ... Cell lines were routinely checked for mycoplasma contamination using PlasmoTest (rep-pt-1, InvivoGen).
-
bioRxiv - Genomics 2023Quote: ... The cells that were successfully transduced were selected with 10 μg/mL Blasticidin (InvivoGen) for a week ...
-
bioRxiv - Immunology 2023Quote: ... and HEK-Dual RNA 4KO MDA5 cell lines were developed by InvivoGen (CA, USA). They are derived from the human embryonic kidney 293 (HEK293)-Dual cell line harboring the stable integration of two inducible reporter genes for SEAP (secreted embryonic alkaline phosphatase ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected with 100 µg/mL Hygromycin B Gold (Invivogen, #ant-hg-5). Selected clones were isolated and GFP expression was confirmed by Western blotting and flow cytometry.
-
bioRxiv - Molecular Biology 2024Quote: To monitor changes in cytosolic and mitochondrial translation cells were labelled with puromycin (Invivogen) and SUNsET was performed as previously described32 ...
-
bioRxiv - Genomics 2024Quote: ... the td-Tomato-positive cells were selected using puromycin antibiotic selection (1μg/ml) (InvivoGen) and were kept under selection until the positive colonies reached 60-80% confluence ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were maintained in the presence of 5 µg/mL blasticidin (Invivogen, ant-bl) and 200 µg/mL zeocin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Single-cell colonies were subsequently isolated by selection with puromycin (5 µg/ml; InvivoGen) and the phenotype was analyzed by Western blot.
-
bioRxiv - Microbiology 2023Quote: ... followed by continued maintenance in cell culture media supplemented with 10µg/mL Blasticidin (InvivoGen).
-
bioRxiv - Microbiology 2024Quote: ... The cells were washed twice with PBS and stained with Fc-hDectin-1a (Invivogen) and Calcofluor white (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and positive cells were selected using 2 μg/mL puromycin (InvivoGen, ant-pr-1) for GFP and mCherry or 1 mg/mL G-418 solution (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... After 48 hrs the cells were selected with 10 µg/ml blasticidin (InvivoGen, ant-bl) for 7 days ...
-
bioRxiv - Microbiology 2019Quote: ... Transduced cells were then selected with both 3 μg/mL puromycin (InvivoGen #ant-pr-1) and 10 μg/mL blasticidin (InvivoGen #ant-bl-1 ...
-
bioRxiv - Molecular Biology 2021Quote: HEK cell lines were transfected at 70% confluency with 100 ng/mL 3p-hpRNA (Invivogen) using Lipofectamine 2000 ...
-
bioRxiv - Immunology 2019Quote: ... RAW 264.7 cells were pretreated with MAb-mTLR2 (2 µg/ml) or isotype (Invivogen, US) for 2 h ...
-
bioRxiv - Cell Biology 2019Quote: ... the cells were selected using DMEM containing 10 µg/ml Blasticidin S (Invivogen, Toulouse, France) for 7 days ...
-
bioRxiv - Microbiology 2019Quote: ... was assessed according to manufacturer protocol using THP1-XBlue™ cell line (InvivoGen, Toulouse France). THP1-XBlue™ cells derive from the human monocytic THP-1 cell line and express an NF-κB- and AP-1-inducible secreted embryonic alkaline phosphatase (SEAP ...
-
bioRxiv - Immunology 2019Quote: ... Splenic B cells were stimulated with either 1 μg/ml LPS (LPS-EB Ultrapure, InvivoGen), 1 μg/ml LPS + 20 ng/ml IL4 (Recombinant Murine IL-4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... but following transfection the cells were plated into conditioned media in 0.1µg/ml Puromycin (Invivogen). Correct integration of the construct in transfected cells was tested using PCR with a forward primer upstream of the 5’UTR of EP1 (agtccgataggtatctcttattagtatag ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stable clones were established by culturing cells in media containing puromycin (1 μg/ml, InvivoGen) or blastocidin (5μg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLV-mCherry stably infected cells were selected for 7 days with 1µg/mL puromycin (InVivoGen).
-
bioRxiv - Cell Biology 2021Quote: ... Cells were primed with a final concentration of 20 ng/ml LPS-EB ultrapure (InvivoGen) for 2 hrs in a cell incubator ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cas9-expressing cells were generated by lentiviral transduction of lentiCas9-Blast followed by Blasticidin (InvivoGen) selection and validation of Cas9 expression and activity ...
-
bioRxiv - Cell Biology 2022Quote: ... The day following transfection cells were treated with selection antibiotics: 10 μg/ml blasticidin (Invivogen) and 50 μg/ml hygromycin B (Thermo Fisher Scientific) ...