Labshake search
Citations for Invivogen :
451 - 500 of 1243 citations for 7 BROMO 2 1 3 BENZOTHIADIAZOLE 4 SULFINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Immunology 2020Quote: ... Levels of SEAP were detected in the culture media after 3 hours incubation of supernatants with Quanti-Blue solution (InvivoGen, San Diego, CA, USA) at 650nm wavelength by ELISA reader.
-
bioRxiv - Genetics 2023Quote: ... the following were added directly to worm plates 3 days after injection: HygR selection −100 ul of 20 mg/ml Hygromycin (HygroGold™ InvivoGen, San Diego, CA) or Hygromycin B ...
-
bioRxiv - Immunology 2021Quote: Human PBMC or purified primary cDCs were cultured in RPMI 1640 media supplemented with 10% Fetal Bovine Serum (HyClone) alone or in the presence of either 1μg/ml 2’3’-c’diAM(PS)2 (Invivogen) or 5μg/ml Poly I:C (SIGMA ...
-
bioRxiv - Microbiology 2020Quote: ... adjuvanted with 500 μg aluminium hydroxide (Alhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume on days 0 and 28 ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) for 3-5 d at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... by limiting-dilution and allowed to expand in growth medium supplemented with 2 μg/ml puromycin (InvivoGen) and 8 μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Immunology 2022Quote: ... HEL2XOVApep or HEL3XOVApep adsorbed on 45 or 90 µg alum adjuvant (Alhydrogel, InvivoGen cat. 21645-51-2).
-
bioRxiv - Immunology 2022Quote: SiO2 crystals free of bacterial contamination (Nano-SiO2, diameter less than 100 nm, InvivoGen, #tlrl-sio-2) at a concentration of 10 mg/ml supplemented with phenol red ...
-
bioRxiv - Microbiology 2021Quote: Human IgA was purified from fecal supernatants with Peptide M/ Agarose (InvivoGen, Cat. No. gel-pdm-2) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2%, vac-alu-250, InvivoGen, San Diego, CA, USA) in 100 μl volume ...
-
bioRxiv - Immunology 2022Quote: ... or both) mixed with Alum (Alhydrogel®; aluminum hydroxide adjuvant 2%, 25 µL, 250 µg/dose; InvivoGen) and suspended in saline with incubated for 1 hour at room temperature with gentle rotation for adsorption prior to vaccination ...
-
bioRxiv - Immunology 2023Quote: ... compounds were added 2 hr before stimulation of cells at the following concentrations: 5 µM MCC950 (Invivogen), 10 µg/mL Ac-YVAD-cmk (Invivogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... and absorbance levels were detected at 655 nm after 2 h incubation with QUANTI-Blue Solution (Invivogen). Nonlinear regression fits were estimated using the “Log(agonist ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Immunology 2022Quote: ... blasticidin (Invivogen, cat. no. ant-bl-1, at 10 μg ml−1), and zeocin (Invivogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1 µg/ml puromycin (Invivogen ant-pr-1).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were selected with 1 µg/mL puromycin (ant-pr-1, Invivogen) and pooled if the expression was homogeneous or cloned otherwise.
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 1:1 vol/vol AddaVax (InvivoGen vac-adx-10) to reach a final dose of 1 µg (S2P ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% P/S and 100 µg/ml Normocin (Invivogen ant-nr-1). 10 µg/ml of Blasticidin (Invivogen ant-bl-05 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 1% Primocin (InvivoGen). Sphingosine-1-phosphate (0.2 - 2μM ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg pppRNA (Invivogen) was added to 100 μl LyoVec (Invivogen) ...
-
bioRxiv - Immunology 2020Quote: ... Pam2CGDPKHPKSF (FSL-1) (InvivoGen) (200ng/ml) ...
-
bioRxiv - Immunology 2019Quote: ... R406 (1 µM; InvivoGen) was used for inhibiting Spleen tyrosine kinase activation ...
-
bioRxiv - Cell Biology 2023Quote: ... diABzL (1 μM, Invivogen), cGAMP (10 μg ml-1 ...
-
bioRxiv - Immunology 2023Quote: ... 60uM Necrostatin-1 (Invivogen) for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: ... Mice (8 mice per group) were intramuscularly injected twice at four-week intervals with each VLPs (HA content=3 µg) with AddaVax™ adjuvant (Invivogen, San Diego, CA, USA) (Figure 2) ...
-
bioRxiv - Microbiology 2021Quote: ... Fibroblasts were then transduced with lentiviruses and selected with 1 μg/mL puromycin for 1 week before being used (ant-pr-1, Invivogen, USA).
-
bioRxiv - Immunology 2021Quote: ... Specific wells were pre-cultured for 2 hours with either 10mg/ml of TLR4 inhibitor (CLI-095, Invivogen) or 10mg/ml PI3 Kinase inhibitor (LY294002 ...
-
bioRxiv - Bioengineering 2022Quote: ... 293-cov2-sdf) or 2) Delta/B.1.617.2 variant) (Catalogue code: 293-SARS2-S-V8-dfur) were purchased from Invivogen. The cells were grown in DMEM media containing 10% Fetal Bovine Serum ...
-
bioRxiv - Immunology 2021Quote: ... injection of 10 mg/kg poly(I:C) for 6h followed by 2 mg/kg ultrapure LPS-B5 (InvivoGen) prepared from E ...
-
bioRxiv - Immunology 2020Quote: ... ovalbumin (OVA) EndoFit (5 μg/mouse) and Alhydrogel adjuvant 2% (alum, 100 μg/mouse) were purchased from Invivogen; recombinant hemagglutinin (rHA ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then stimulated by adding 40 ml of fresh medium containing 1µg/ml of 2’3’-cGAM(PS)2 (Invivogen) for 24 hours ...
-
bioRxiv - Immunology 2023Quote: ... the cultures were incubated with or without a bacterial agonist cocktail (2ug/mL Pam3CSK4 (TLR1/2 agonist, InvivoGen), 1 ug/mL FSL-1 (TLR2/6 agonist ...
-
bioRxiv - Microbiology 2023Quote: ... ACE2 and transmembrane serine protease 2 (TMPRSS2)-expressing A549 (ACE2-TMPRSS2-A549) cells were from Invivogen (#a549-hace2tpsa) and HEK293T were from ATCC (#CRL-11268) ...
-
bioRxiv - Bioengineering 2023Quote: ... The transfected cells were expanded to T-75 flasks and cultured with 2 µg/mL of puromycin (Invivogen), 10 µg/mL of blasticidin (Invivogen ...
-
bioRxiv - Genomics 2023Quote: ... cells were cultured in the same medium supplemented with 200 μg/ml HygromycinGold B (Invivogen ant-hg-2). To generate cells with constitutive BFP expression ...
-
bioRxiv - Immunology 2020Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant (Invivogen) to reach a final concentration of 0.009 or 0.05 mg/mL antigen ...
-
bioRxiv - Immunology 2022Quote: ... and zeocin (Invivogen, cat. no. ant-zn-1, at 200 μg ml−1).
-
bioRxiv - Neuroscience 2023Quote: ... and kept in media with 1 µg/mL Puromycin (Invivogen, ant-pr-1). To induce LRP10 expression ...
-
bioRxiv - Molecular Biology 2023Quote: ... P0883) or 1 μg ml−1 flagellin from Salmonella typhimurium (Invivogen, tlrl-stfla), respectively ...
-
bioRxiv - Immunology 2024Quote: ... 100 μg EVSpikeM+P (1:1 mixed with Alhydrogel, InvivoGen, vac-alu-250) intramuscularly in the quadriceps (day 0) ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2×106 cells were nucleofected with 1 μg TetO targeting vector and 1 µg of PX459-ch15_gRNA/Cas9) as described above and treated with 1 µg/ml of puromycin (InvivoGen, ant-pr-1) 48h after transfection for 3 days to select cells for insertion of the TetO cassette ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein translation was inhibited with 50 µg·mL-1 of puromycin (ant-pr-1, Invivogen).
-
bioRxiv - Immunology 2020Quote: ... RBD-SpyVLP was mixed 1:1 (25 µL + 25 µL) with AddaVax adjuvant (Invivogen). Mouse experiments were performed according to the UK Animals (Scientific Procedures ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 μg ml−1 blasticidin and 25 μg ml−1 G418 (all from Invivogen).