Labshake search
Citations for Invivogen :
451 - 500 of 638 citations for 5 Pyrimidinecarbonitrile 2 4 diamino 6 methyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... and then diluted 1:2 with ice cold PBS with 1% (v/v) primocin (InvivoGen). Material that filtered through a 70 μm cell strainer was collected and referred to as jejunal epithelial cell fraction one (IEC-1) ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% advanced fetal bovine serum (FBS, Capricorn) and 2 µg/mL puromycin (InvivoGen). For AAV production ...
-
bioRxiv - Immunology 2023Quote: ... with 2% NuSerum medium (29) supplemented with Primocin (50 µg/ml, (InvivoGen, San Diego, CA), and retinoic acid (1 x 10−8 M ...
-
bioRxiv - Genomics 2019Quote: ... supplemented with 5% human platelet lysate (Cook Regentec, #G34936) and 50 µg/mL Primocin (InvivoGen, #ant-pm-1). hASCs were cultured in the same media composition until 70-80% confluency and detached using TrypLE Select (Life Technology ...
-
bioRxiv - Bioengineering 2021Quote: The vaccines contained a 10 µg dose of RBD and combinations of 5 µg Quil-A Adjuvant (Invivogen), 50 µg Resiquimod (R848 ...
-
bioRxiv - Cancer Biology 2021Quote: ... the medium was exchanged for 10 mL DMSO-free medium containing 5 mg/mL Primocin (Invivogen, Toulouse, France), the tissue was minced in 10mL basal NSC in a cell culture petri dish using a sterile scalpel blade ...
-
bioRxiv - Immunology 2020Quote: Resiquimod gill challenge was performed as previously described (33) using 5 μL of Resiquimod (0.5 mg/mL; Invivogen) applied to the gills for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... Stained cells were cultured for 5 days in BCM supplemented or not with CpG (ODN2006, 2,5µg/ml, Invivogen), or cocultured with MS40 cells expressing CD40L and cytokine cocktail (recombinant human BAFF (10 ng/ml) ...
-
bioRxiv - Microbiology 2020Quote: ... All HEK293 Flp-In T-REx cell lines were additionally supplemented with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were selected using McCoy’s medium containing 2.5 – 5 µg/mL Blasticidin S (Invivogen # ant-bl-05) for 7 days ...
-
bioRxiv - Genetics 2024Quote: ... 5 µL of the ligated construct were transferred to chemically competent E.coli GT115 cells (pir mutant strain, Invivogen) and spread on lysogeny broth (LB ...
-
bioRxiv - Immunology 2022Quote: ... The cells were then plated on 12 mm cover slides in a 24-wells plate and then treated 4 h with 100 nM Bafilomycin A1 (Invivogen), 333 nM Torin 1 (Invivogen ...
-
bioRxiv - Immunology 2024Quote: ... with WT or Sulf2+/- antigen-presenting cells (BMDM or DCs) activated with LPS (100 ng/ml LPS, 4 h, InvivoGen). As a source of antigen ...
-
bioRxiv - Immunology 2023Quote: ... the luciferase detection reagent QUANTI-Luc 4 Lucia/Gaussia (Cat. #.: rep-qlc4lg1) and the SEAP detection reagent QUANTI-Blue 4 (Cat. #.: rep-qbs) were purchased from InvivoGen. Cell staining antibodies for the flow cytometry analysis ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of cell mixture was transferred to a white opaque 96-well plate and treated with 50 μL of QUANTI-Luc 4 Lucia/Gaussia (InvivoGen) and immediately read using luminescence at 0.1 second read time ...
-
bioRxiv - Developmental Biology 2021Quote: ... Mice were injected with the following drugs and euthanized after 2 hours: Poly(I:C) HMW (Invivogen), IP injection 10mg/kg (Pietras et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... Infected cells were selected for by the addition of 2 μg/mL puromycin (InvivoGen; ant-pr). Expression was verified by SDS-PAGE and/or BN-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: ... cells infected with shRNA encoding virus were selected in puromycin (2 μg/mL, InvivoGen, ant-pr) and used 4 days post infection.
-
bioRxiv - Immunology 2022Quote: ... 2 mM (peritoneal macrophages) ATP or 50 µM (THP-1 differentiated macrophages) R837 (InvivoGen, tlrl-imqs) for 30-60 min ...
-
bioRxiv - Cancer Biology 2020Quote: MDA-MB-231 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen), using TurboFect™ followed by Blasticidin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... filter sterilised and tested for endotoxin content using the HEK-Blue LPS detection kit 2 (InvivoGen) and found to have <0.002 EU endotoxin per mg of protein ...
-
bioRxiv - Microbiology 2023Quote: ... Envelope defective virus was pseudotyped with HU-1 SARS-CoV-2 Spike protein (pLV-Spike, Invivogen) and used for single round infection assays ...
-
bioRxiv - Microbiology 2023Quote: ... B.1.1.529/BA.1 SARS-CoV-2 spike plasmid (plv-spike-v11) was obtained from InvivoGen and subcloned into pcDNA3.1-puro ...
-
bioRxiv - Immunology 2023Quote: ... MEFs or BMDMs were transfected with 2 µg/ml Interferon Stimulatory DNA (ISD, tlrl-isdn, InvivoGen) complexed with Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibiotic selection was applied two days after transfection (2 μg/mL puromycin (#ant-pr-1, Invivogen) for 3 days).
-
bioRxiv - Immunology 2023Quote: ... cells were incubated for 2 hours with or without TLR2 blocking antibody (Invivogen cat.# mab2-mtlr2) followed by incubation with CEP or Pam3CSK4 (Invivogen cat.# tlrl-pms ...
-
bioRxiv - Bioengineering 2024Quote: ... Alum samples were prepared by performing a 1:1 dilution of 2% Alhydrogel® adjuvant (InvivoGen) with stock solutions of 400 μg/mL endotoxin-free OVA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and then selected in the culture medium containing 2 µg/ml puromycin (InvivoGen, ant-pr-1).
-
bioRxiv - Cancer Biology 2023Quote: ... Regular testing for mycoplasma infection was conducted every 3–4 months using the PlasmoTest mycoplasma detection kit (InvivoGen, catalog # rep-pt1). No other authentication assay was performed.
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... To analyze the interferon response HEK-Dual hTLR3 cells were treated with 5 μg/ml poly(I:C) HMW (InvivoGen) or the different extracted media for four hours ...
-
bioRxiv - Immunology 2019Quote: ... or PAL-CRID3 (0.001-100 µM) for 30 min and then stimulated with 5 μg mL−1 nigericin (Invivogen) for 30 min.
-
bioRxiv - Microbiology 2021Quote: ... 5 μg of SpK combined with either BCG (BCGSpK) or 100 μg of Alhydrogel (Alum) (Invivogen, California, USA, AlumSpK), or a combination of BCG (5×105 CFU) ...
-
bioRxiv - Microbiology 2020Quote: ... using the calcium phosphate precipitation technique and selected by treating the cells with 5 µg/mL Blasticidin S (Invivogen) and 200 µg/mL Hygromycin B (Invivogen).
-
bioRxiv - Microbiology 2022Quote: ... cells were washed for 5 minutes in PBS and incubated into PBS 1X with 1.67ug/mL of DAPI (Invivogen). Cells were washed for 5 minutes in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... cells were transfected with 100 ng/ml of the RIG-I agonist 5’ triphosphate hairpin RNA (3p-hpRNA, Invivogen) complexed to Lipofectamine 2000 (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... and cells were stimulated with 100 μl milk EVs or EV-depleted controls in the presence or absence of 5 μg/ml Poly I:C (Invivogen). After 4 or 5 hours ...
-
bioRxiv - Cell Biology 2021Quote: Endogenously tagged cell lines were maintained in HMI-9 supplemented with 20 % (v/v) FCS at 37 °C in 5% C02 and maintained in 10 µg.mL-1 Blasticidin (InvivoGen). Parasite density was monitored using a haemocytometer.
-
bioRxiv - Biochemistry 2019Quote: ... coli NucC bound to 5’-pApA or cAAA in hanging drop format by mixing protein (8-10 mg/mL) in crystallization buffer plus 0.1 mM 5’-pApA (Invivogen) or cAAA 1:1 with well solution containing 17-24% PEG 3350 ...
-
bioRxiv - Immunology 2021Quote: ... uninfected animals were treated intratracheally with 0.5 μg/kg of body weight of 5-OP-RU and 100 μg of CpG ODN 2006 (InvivoGen) mixed with 10 mg/kg of body weight of either rhesus macaque IgG4 isotype control antibody (DSPR4 ...
-
bioRxiv - Immunology 2020Quote: ... of 5 μg of each mAb (αDEC-NS1, αDCIR2-NS1, αDEC or αDCIR2) together with 50 μg poly (I:C) (Invivogen), exactly as described in (17) ...
-
bioRxiv - Microbiology 2021Quote: ... adjuvanted with MPLA-AddaVax (Per animal: 5 μg MPLAs, InvivoGen, cat# vac-mpls; 50μL AddaVax, InvivoGen, cat#-adx-vac) in a 100 µl injection volume via the intramuscular route (50 µl per hind leg) ...
-
bioRxiv - Immunology 2021Quote: ... the cells were pre-incubated for 30 min at 37°C with 5 μg/mL of anti-TLR2 monoclonal antibody (clone T2.5, InvivoGen) or with an isotype control (mIgG1 ...
-
bioRxiv - Immunology 2020Quote: ... mice were immunized with 1E3 or 1E4 colony forming units of Vaccinia Western Reserve or 5 μg of Poly I:C (Invivogen) with or without 5μgof anti-CD40 (FGK4.5 ...
-
bioRxiv - Genomics 2021Quote: ... 50,000 PBMCs from each individual were incubated for 10 hours at 37C and 5% CO2 in either the presence or absence of LPS (0.1 ug/mL, Invivogen ultrapure LPS from E ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were selected with 2.5 µg/ml (PC3) and 5 µg/m (DU145) of blasticidin (InvivoGen ant-bl-1) for 7-9 days ...
-
bioRxiv - Immunology 2023Quote: ... Adenosine 5’-triphosphate disodium salt (ATP, CAS: 987-65-5), poly(dA:dT), and nigericin (Nig, CAS: 28643-80-3) were from InvivoGen. Cross linker disuccinimidyl suberate (DSS ...
-
bioRxiv - Immunology 2024Quote: ... mice were immunized with 1E4 plaque-forming units (PFU) of Vaccinia Western Reserve or 5 µg of poly I:C (Invivogen) with or without 5 µg of anti-CD40 (FGK4.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Human CD14+ monocytes (2×106/ml) were pre-incubated with human anti-Dectin-1 (10μg/ml, Invivogen), anti-TLR2 blocking antibodies (10μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were transferred into 10 cm dishes and selected with 2 µg ml-1 puromycin (InvivoGen). After 7-10 days ...