Labshake search
Citations for Invivogen :
451 - 500 of 1214 citations for 5 Oxo 5 3 oxo 3 4 dihydro 2H quinoxalin 1 yl pentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... supplemented with 100 μg ml-1 primocin (ant-pm-1, InvivoGen) in the apical channel.
-
bioRxiv - Immunology 2020Quote: ... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
bioRxiv - Immunology 2020Quote: ... 5μg of PR8-HA protein with Addavax (1:1 ratio; InvivoGen) and 0.5% tattoo ink was injected into the left quadriceps and right gastrocnemius (50 μL per site) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% Primocin (Invivogen #ant-pm-1, San Diego, CA, USA). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... Clec7a or Dectin-1 (rat monoclonal, 1:100; Invivogen, mabg-mdect), Trem2 (sheep polyclonal ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2ug mL-1 (InvivoGen, ant-pr-1), the jurkat cells were harvested at several different timepoints ranging from 7 days to 14 days ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Following puromycin selection at 2µg mL-1 (InvivoGen, ant-pr-1), the nucleofected cells were harvested at several different timepoints ranging from 6 days to 41 days ...
-
bioRxiv - Immunology 2024Quote: ... Cells were stimulated with LPS (1 ng ml-1; Invivogen, USA), FSL-1 (100 ng ml-1 ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-ppp-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (Catalog Code, lyec-12, InvivoGen), following the manufacturer’ ss instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... or ss-miRNA-21 (2, 4 or 8 µg/ml) were transfected into the cells using LyoVec™ (InvivoGen, Catalog Code. lyec-12, InvivoGen) following the manufacturer’ ss instructions ...
-
bioRxiv - Immunology 2024Quote: ... or GpC:ODN control (n=4) (CpG-B no.1826, TCCAT GACG TTCCT GACGTT; control non-CpG-B no.2138, TCCATGAGCTTCCTGAGCTT, Invivogen, USA). At 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Immunology 2022Quote: ... blasticidin (Invivogen, cat. no. ant-bl-1, at 10 μg ml−1), and zeocin (Invivogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 1 µg/ml puromycin (Invivogen ant-pr-1).
-
bioRxiv - Cell Biology 2023Quote: ... Cells were selected with 1 µg/mL puromycin (ant-pr-1, Invivogen) and pooled if the expression was homogeneous or cloned otherwise.
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 1:1 vol/vol AddaVax (InvivoGen vac-adx-10) to reach a final dose of 1 µg (S2P ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% P/S and 100 µg/ml Normocin (Invivogen ant-nr-1). 10 µg/ml of Blasticidin (Invivogen ant-bl-05 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 1% Primocin (InvivoGen). Sphingosine-1-phosphate (0.2 - 2μM ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 μg pppRNA (Invivogen) was added to 100 μl LyoVec (Invivogen) ...
-
bioRxiv - Immunology 2020Quote: ... Pam2CGDPKHPKSF (FSL-1) (InvivoGen) (200ng/ml) ...
-
bioRxiv - Immunology 2019Quote: ... R406 (1 µM; InvivoGen) was used for inhibiting Spleen tyrosine kinase activation ...
-
bioRxiv - Cell Biology 2023Quote: ... diABzL (1 μM, Invivogen), cGAMP (10 μg ml-1 ...
-
bioRxiv - Immunology 2023Quote: ... 60uM Necrostatin-1 (Invivogen) for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Fibroblasts were then transduced with lentiviruses and selected with 1 μg/mL puromycin for 1 week before being used (ant-pr-1, Invivogen, USA).
-
bioRxiv - Immunology 2020Quote: ... immunogen suspensions were gently mixed 1:1 vol/vol with AddaVax adjuvant (Invivogen) to reach a final concentration of 0.009 or 0.05 mg/mL antigen ...
-
bioRxiv - Immunology 2022Quote: ... and zeocin (Invivogen, cat. no. ant-zn-1, at 200 μg ml−1).
-
bioRxiv - Molecular Biology 2023Quote: ... P0883) or 1 μg ml−1 flagellin from Salmonella typhimurium (Invivogen, tlrl-stfla), respectively ...
-
bioRxiv - Neuroscience 2023Quote: ... and kept in media with 1 µg/mL Puromycin (Invivogen, ant-pr-1). To induce LRP10 expression ...
-
bioRxiv - Immunology 2024Quote: ... 100 μg EVSpikeM+P (1:1 mixed with Alhydrogel, InvivoGen, vac-alu-250) intramuscularly in the quadriceps (day 0) ...
-
bioRxiv - Microbiology 2020Quote: ... appropriate antibiotics were added (10 µg mL-1 blasticidin [InvivoGen], 40 µg mL-1 puromycin [InvivoGen], 15 µg mL-1 G418 [InvivoGen]) to select for transfectants ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2×106 cells were nucleofected with 1 μg TetO targeting vector and 1 µg of PX459-ch15_gRNA/Cas9) as described above and treated with 1 µg/ml of puromycin (InvivoGen, ant-pr-1) 48h after transfection for 3 days to select cells for insertion of the TetO cassette ...
-
bioRxiv - Molecular Biology 2020Quote: ... Protein translation was inhibited with 50 µg·mL-1 of puromycin (ant-pr-1, Invivogen).
-
DNA writing at a single genomic site enables lineage tracing and analog recording in mammalian cellsbioRxiv - Synthetic Biology 2019Quote: ... transformants were selected with 1-2 ug/mL of puromycin (Invivogen #ant-pr-1), then a single colony was isolated in two rounds of dilution and colony picking.
-
bioRxiv - Immunology 2020Quote: ... RBD-SpyVLP was mixed 1:1 (25 µL + 25 µL) with AddaVax adjuvant (Invivogen). Mouse experiments were performed according to the UK Animals (Scientific Procedures ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 μg ml−1 blasticidin and 25 μg ml−1 G418 (all from Invivogen).
-
bioRxiv - Cancer Biology 2023Quote: ... 0.2 μg/mL hydrocortisone and 50 μg mL-1 Primocin (InvivoGen #ant-pm-1). HIMEC cells used for chip conditions were between passage 6 and 8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transduced cells were selected using 1 μg/mL puromycin (InvivoGen, cat. ant-pr-1).
-
bioRxiv - Microbiology 2019Quote: ... blasticidin (1 μg/mL, Invivogen) was added to media ...
-
bioRxiv - Neuroscience 2020Quote: ... Puromycin (1 μg/ml, InvivoGen) was added for two days from DIV2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Blasticidin (Invivogen: ANT-BL-1) was supplemented into media 48h post-transduction for relevant plasmid (LRT2B ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mg/mL Zeocin (InvivoGen), 2 μg/mL Puromycin (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2022Quote: ... + 1:5000 Primocin® (Invivogen). Media used for alveolar culture conditions was based on conditions for primary mouse AT2 (C12 ...
-
bioRxiv - Cell Biology 2022Quote: ... Puromycin (Invivogen, ant-pr-1), Zeocin (Invivoge8).
-
bioRxiv - Immunology 2020Quote: ... 1 µg/ml Pam3CSK4 (Invivogen), or both ...
-
bioRxiv - Immunology 2020Quote: ... HA-IPS-1(MAVS) (Invivogen), IFN-β-luc (Michael Gale ...
-
bioRxiv - Cell Biology 2022Quote: ... Blasticidin (InvivoGen, ant-bl-1), Geneticin (G-418 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Primocin (1 mg/ml, InvivoGen), N-acetyl-L-cysteine (1 mM ...
-
bioRxiv - Cancer Biology 2019Quote: ... cGAMP (InvivoGen, 1 × 25 μg) was injected i.t ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg/ml phleomycin (InvivoGen); 5 µg/ml hygromycin (InvivoGen) ...
-
bioRxiv - Immunology 2021Quote: ... with 1 μM CL097 (Invivogen), 100 ng/mL LPS (Invivogen) ...