Labshake search
Citations for Biotium Inc. :
1 - 50 of 160 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... 99% purity] was from Biotium (Fremont, California). Other chemicals were from Sigma-Aldrich.
-
bioRxiv - Molecular Biology 2022Quote: ... 100 ng/mL MitoView Green (Biotium 70054-T) is added at this point as well ...
-
bioRxiv - Neuroscience 2021Quote: ... and 20 μg/mL CF488A-WGA (Biotium) in the absence (control ...
-
bioRxiv - Bioengineering 2022Quote: ... including 1 μg/mL calcein-AM and 20 μg/mL propidium iodide (Biotium) were added to the culture medium to selectively stain live (green ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μg of RNA were biotinylated in biotinylation buffer (10 mM Tris-HCl pH 7.4, 1 mM EDTA, 20 ng/μl MTSEA Biotin-XX (Biotium)) for 30 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... MTSEA-biotin (N-biotinylaminoethyl-methanethiosulfonate, Biotium) (500 µM ...
-
bioRxiv - Microbiology 2022Quote: ... and n were from Biotium (Fremont, CA); and coelenterazine e ...
-
bioRxiv - Cell Biology 2020Quote: ... antibody labeling kit Mix-n-Stain CF640R (Biotium); heme (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: ... the sample was then incubated for 10 min with 400 ng ml−1 WGA-CF680 (catalog no. 29029-1, Biotium) in 100 mM Tris pH 8.0 ...
-
bioRxiv - Systems Biology 2024Quote: ... 20× EvaGreen (Biotium) was employed as the fluorescent dye ...
-
bioRxiv - Genomics 2022Quote: ... Drop-n-Stain CF 488A Donkey Anti-Rabbit IgG (Biotium 20950), Drop-n-Stain CF 594 Donkey Anti-Rabbit IgG (Biotium 20951) ...
-
bioRxiv - Genomics 2022Quote: ... Drop-n-Stain CF 594 Donkey Anti-Rabbit IgG (Biotium 20951), IRDye 650 Goat anti-Mouse IgG Secondary Antibody (LI-COR Biosciences 926-65010) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were stained with 7 μM Calcofluor White for 20 minutes and 50 μg/mL of Concanavalin A (both obtained from Biotium, Fremont CA) for 30 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... for 15~20 min before loading the voltage-sensitive dye RH237 (1.25 mg/ml dye stock solution in DMSO, Biotium, catalog number 61018) and calcium-sensitive dye Rhod-2 AM (1 mg/ml dye stock solution in DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mL of each fecal inoculum was mixed with 2.5 µL of 20 mM propidium monoazide (PMA) dye (Biotium, Fremont, CA, USA). The samples were then incubated in the dark for 5 min ...
-
bioRxiv - Cell Biology 2022Quote: ... and rhodamine-phalloidin (1:20; Biotium) in permeabilization/blocking buffer at room temperature for 2 hours in the dark ...
-
bioRxiv - Biophysics 2021Quote: ... DPA (20 mM in DMSO; Biotium) was diluted right before use in HEK external solution (detailed below) ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng of MTSEA-biotin-XX (Biotium 89139-636) dissolved in 10 μl of Dimethyl formamide (Sigma D4551 ...
-
bioRxiv - Systems Biology 2019Quote: ... Mix-n-Stain CF555 and CF640R antibody labeling kits were purchased from Biotium Inc ...
-
bioRxiv - Genetics 2022Quote: ... and mounted with Drop-n-Stain EverBrite Mounting Medium with DAPI (BIOTIUM: 23009). All specimens were imaged using Zeiss Axio Imager.M1 fluorescence microscope with a 63X plan-apo Chromat oil objective ...
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were then mounted in Drop-n-Stain EverBriteTM Mounting Medium (Biotium #23008) onto slides and imaged using Zeiss Axio Imager Z1 fluorescence microscope.
-
bioRxiv - Molecular Biology 2020Quote: ... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ...
-
bioRxiv - Neuroscience 2024Quote: ... and phalloidin CF488 (1:20, Biotium #00042) in the blocking solution ...
-
bioRxiv - Neuroscience 2020Quote: Intracellular chloride measurements were performed using the N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide (MQAE) (Biotium) chloride sensor.
-
bioRxiv - Neuroscience 2023Quote: ... Retinae were then mounted in Drop-n-Stain EverBrite™ Mounting Medium (Biotium #23008) onto slides and imaged using Zeiss Axio Imager Z1 fluorescence microscope.
-
bioRxiv - Cell Biology 2023Quote: ... conjugated to CF555 (Mix-n-Stain CF Antibody Labeling Kit, Biotium, Fremont, CA, USA)
-
bioRxiv - Cell Biology 2020Quote: ... Cell populations deposited onto each slide were stained with GelGreen (P/N 41005; Biotium, Inc.) following manufacturer’s protocols ...
-
bioRxiv - Immunology 2020Quote: ... and Mix-n-Stain cf dye antibody labeling kit for CF405M (Biotium, Fremont, CA, USA), respectively ...
-
bioRxiv - Plant Biology 2022Quote: ... 20 µM DiBAC4(3) (Biotium, Fermont, CA, USA) for membrane potential imaging (Fichman and Mittler ...
-
bioRxiv - Neuroscience 2022Quote: ... Trublack (1:20 in 70% ethanol; Biotium #23007) was pipetted to cover each section for 1 minute before being rinsed off ...
-
bioRxiv - Cell Biology 2020Quote: ... PCNA antibody was pre-labeled using a Mix-n-StainCF-568 Dye Antibody Labeling Kit (Biotium; 92275) accordingly to the manufacturer protocol.
-
bioRxiv - Cell Biology 2022Quote: ... primary antibodies were directly conjugated to fluorophores using Mix-n-Stain CF Dye Antibody Labeling Kits (Biotium) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... Dye conjugation was performed using the Mix-n-Stain CF405M Antibody Labeling Kit (Biotium, Fremont, CA USA). Anti-TERT antibody conjugated with CF405M was diluted at 1:5 in storage buffer.
-
bioRxiv - Cell Biology 2023Quote: ... primary antibodies were first labelled with fluorescent dyes using the Mix-n-Stain antibody labelling kit (Biotium) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... EvaGreen® dye (20×) was purchased from Biotium (Fremont, CA). TEMED ...
-
bioRxiv - Cancer Biology 2022Quote: ... we diluted the quencher 1:20 as specified by Biotium. Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... APC-conjugated normal mouse IgG was produced using the Mix-n-Stain™ APC Antibody Labeling kit from Biotium Inc ...
-
bioRxiv - Neuroscience 2023Quote: ... CAR antibodies were conjugated with the CF647 fluorophore (CAR-647) using the Mix-n-Stain antibody labeling kit according to the manufacturer’s protocol (Biotium). Sections were processed first with rabbit polyclonal Cav1.4 or EAAT2 antibodies and corresponding secondary antibodies as described above ...
-
bioRxiv - Microbiology 2021Quote: ... Worms were resuspended in 20 μl EverBrite™ Mounting Medium (Biotium) and mounted on slides for imaging ...
-
bioRxiv - Genetics 2020Quote: ... Samples were pulse centrifuged up to 1200 rpm and split in two, where one part (n = 230, PMA treated samples) was added PMA dye (Biotium, USA to a final concentration of 50 µM ...
-
bioRxiv - Microbiology 2021Quote: ... Animals were mounted in 20 μl of EverBrite™ Mounting Medium (Biotium) and placed on glass slides for imaging.
-
bioRxiv - Microbiology 2021Quote: ... Stained worms were resuspended in 20 μl EverBrite™ Mounting Medium (Biotium) and mounted on slides for imaging ...
-
bioRxiv - Developmental Biology 2020Quote: ... was conjugated to Alexa 647 using the Biotium Mix-n-Stain R-PE(PE) Antibody Labeling kit (Biotium, cat no: 92298) following the manufacturers protocol ...
-
bioRxiv - Microbiology 2019Quote: ... with CF™ 568 dye (Mix-n-Stain™ CF® Dye Antibody Labeling Kits - CF®568, Biotium Inc, CA), and followed the nonpermeable approach for IFA [12] to investigate the interaction between Ab and ookinetes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-CLEC4F was from R&D (#MAB2784) and coupled to CF568 using the Mix-n-Stain CF568 Antibody Labeling Kit (Biotium, #BTM92235). All antibodies were used at 1:100 dilution ...
-
bioRxiv - Cell Biology 2021Quote: ... Hypotonic shock solution also included 20 µM FM4-64 (Biotium, Fremont, CA, USA) to stain dead protoplasts (Vida and Gerhardt ...
-
bioRxiv - Microbiology 2021Quote: ... Worms were then resuspended in 20 μl of EverBrite™ Mounting Medium (Biotium), and 10 μl mounted on glass slides for imaging.
-
bioRxiv - Genetics 2021Quote: ... DY96-stained worms were resuspended in 20 μl EverBrite™ Mounting Medium (Biotium) and mounted on slides for imaging ...
-
bioRxiv - Systems Biology 2023Quote: ... with 50 μL in each well and 2.5 μL of 20× EvaGreen (Biotium) per well was added ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Furimazine was purchased from Aobious (Gloucester, MA), ceolentrazine and coelentrazine analogues (coelenterazine-f, -h, -fcp, -hcp, -n, and -cp) were purchased from Biotium (Fremont, CA). Polyethyleneimine (PEI ...