Labshake search
Citations for Biotium Inc. :
1 - 50 of 304 citations for Genz 644282 CAS 529488 28 6 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
bioRxiv - Neuroscience 2024Quote: ... Ha and PDa with similar densities were selected and incubated with 6 μM Fluo4-AM (Biotium, Fremont, CA, USA) in HBSS for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were mounted using EverBrite mounting medium with 4′,6-diamidino-2-phenylindole (Cat No. 23002, Biotium, Fremont, CA, USA). Images were recorded by Olympus IX51 microscope with ToupTek camera and with the same exposure parameters (Alexa Fluor™ 555 ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were then washed with PHEM-T and counter-stained with 4′,6-diamidino-2-phenylindole (DAPI, Biotium, Fremont, CA). The cells and coverslips were mounted on glass slides with Prolong Glass Antifade Mountant (Thermo Scientific) ...
-
bioRxiv - Plant Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Biotium) and were examined with a Spinning Disk Carl Zeiss Axio Observer Z1 microscope using 10x magnification or with a Plan Apo 63x Ph3-NA1.4 –DIC HCII Oil immersion objective ...
-
bioRxiv - Systems Biology 2021Quote: Genomic DNA was quantified using Sybr Green fluorescence assay with a 6-point DNA standard curve (0, 0.5, 1, 2, 4, 6 ng/μL Biotium). 1 μL of samples and 5 μL of standards were diluted into 95 μL of 1X SYBR Green (Invitrogen ...
-
bioRxiv - Developmental Biology 2024Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Biotium 40009), rabbit anti-Alexa Fluor™ 488 (Thermo Fisher A11094) ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) was purchased from Biotium, CA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 μL Fast Evagreen qPCR Master Mix (Biotium, 31003), 2 μL of nuclease-free water ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 μM MTS-5(6)-carboxytetramethylrhodamine (MTS-TAMRA; Biotium) for 7 minutes at 4 oC in a depolarizing solution (in mM ...
-
bioRxiv - Cell Biology 2020Quote: ... RedDot1 (Biotium, CA, USA) was diluted 1:1000 into lysis buffer prior to adding to cells ...
-
bioRxiv - Microbiology 2021Quote: ... containing 0.5 μg/ml DAPI (4’,6-diamidino-2-phenylindole, Biotium). Images were acquired on an LSM 700 confocal microscope (Zeiss ...
-
bioRxiv - Cell Biology 2020Quote: ... RedDot1 (Biotium, Hayward, CA, USA) was diluted (1:1000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: MTT solution (Biotium, Hayward, CA) was diluted 1/10 in serum-free antibiotic-supplemented DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... PMAxx (Biotium, Fremont, CA, USA) with a final concentration of 6uM was added ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5X EvaGreen (Biotium, Fremont, CA), 0.02 U/µl Phusion polymerase (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... AM1-43 (Biotium, Fremont, CA) was diluted in sterile PBS and injected subcutaneously near the convergence of the wing and back ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5X EvaGreen (Biotium, Fremont, CA), 0.02 U/µl Phusion polymerase (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... 1X (Biotium, Fremont, CA, USA) as per manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.5× EvaGreen (Biotium, Hayward, CA). The reaction profile consisted of 38 cycles of 94°C for 30 sec ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (10µg/ml, Biotium, cat. number 40043) was used for nuclear staining ...
-
bioRxiv - Cell Biology 2023Quote: ... After nuclear staining with 4’,6-diamidino-2-phenylindole (DAPI) (40043, Biotium) in IF buffer at a final concentration of 0.5 µg/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... After nuclear staining with 4’,6-diamidino-2-phenylindole (DAPI) (40043, Biotium) in IF buffer at a final concentration of µg/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... dihydrochloride (DAPI, 40043, Biotium, CA, America). For immunofluorescence staining of cut paraffin sections ...
-
Rac1, Rac3 GTPases and TPC2 are required for axonal outgrowth and migration of cortical interneuronsbioRxiv - Neuroscience 2022Quote: ... CF®555 (Biotium, Fremont, CA). Nucleii were stained using 4′ ...
-
bioRxiv - Physiology 2022Quote: ... stained with GelRed (Biotium, Hayward, CA) and visualized on Gel Doc System (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 40 μl of 1X 4’,6-diamidino-2-phenylindole (DAPI; Biotium; Reagent Table) was added and the slides were sealed with a coverslip and clear nail polish.
-
bioRxiv - Bioengineering 2021Quote: ... Eva Green Master Mix (Biotium, Fremont, CA) was used with custom-made forward and reverse primers (Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... LipidSpot lipid droplet stain (Biotium, Fremont, CA) was added to the sections and incubated for 20 min ...
-
bioRxiv - Microbiology 2022Quote: ... and n were from Biotium (Fremont, CA); and coelenterazine e ...
-
bioRxiv - Cell Biology 2022Quote: ... Phalloidin conjugates were from Biotium (Fremont, CA). Plasmids encoding Pseudojanin (PJ ...
-
bioRxiv - Genomics 2020Quote: ... and qPCR were from Biotium (Fremont, CA). Oligonucleotides were obtained from IDT (Coralville ...
-
bioRxiv - Molecular Biology 2020Quote: ... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ...
-
bioRxiv - Immunology 2021Quote: ... was conjugated with CF680 (Biotium, Fremont, CA) in 1:10 molar ratio ...
-
bioRxiv - Cell Biology 2021Quote: MitoView™ Green (Biotium, Hayward, CA, USA) was used to stain mitochondria in oocytes ...
-
bioRxiv - Molecular Biology 2023Quote: ... gels containing 0.5x GelRed (Biotium; Fremont, CA), and pseudoexon inclusion was quantified from molar ratios between PCR products using the Fragment Analyzer system (Advanced Analytical Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Gel red was from Biotium (Fremont, CA). Taq DNA polymerase was from Syd Labs (Hopkinton ...
-
bioRxiv - Microbiology 2022Quote: Propidium monoazide (PMA; Biotium, Inc., Fremont, CA) treatment concentrations of 30 and 50 μM and light exposure times of 60 ...
-
bioRxiv - Neuroscience 2024Quote: ... TrueBlack Lipofuscin Autofluorescence Quencher (Biotium, Fremont, CA) diluted in 70% ethanol was added to each slice for 30 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... Rhodamine phalloidin (1:50; Biotium; Fremont, CA), and Hoechst 33342 (1:500 ...
-
bioRxiv - Plant Biology 2022Quote: ... and 20x EvaGreen Dye (Biotium, Hayward, CA) and run as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... and dihydrochloride (DAPI, 40043, Biotium, CA, America). The antibodies (Tables 2 and 3 ...
-
bioRxiv - Physiology 2023Quote: ... di-4-ANEPPS (7.5 µM, Biotium, CA) and positioned to center the anterior descending artery within the field of view ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... or CF405M (# 29028, Biotium, Hayward, CA, USA) and/or DAPI ...
-
bioRxiv - Neuroscience 2020Quote: Intracellular chloride measurements were performed using the N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide (MQAE) (Biotium) chloride sensor.
-
bioRxiv - Biophysics 2021Quote: ... CF640R-amine was purchased from Biotium (Fremont, CA). FuGENE HD transfection reagent was purchased from Promega (Madison ...
-
bioRxiv - Developmental Biology 2020Quote: ... EverBrite™ mounting media from Biotium (Fremont, CA) were used to mount coverslips and protect from photo bleaching.
-
bioRxiv - Neuroscience 2021Quote: ... Fluo-4AM (50μg; Biotium, Fremont, CA; Cat# 50018) was dissolved in 50μl Pluronic F-127 (Biotium ...
-
bioRxiv - Biophysics 2022Quote: ... CF640R-amine was purchased from Biotium (Fremont, CA). FuGENE HD transfection reagent was purchased from Promega (Madison ...
-
bioRxiv - Microbiology 2021Quote: ... was treated with PMA (Biotium, Inc., Hayward, CA) based on manufactureŕs recommendations and as previously described [39] to differentiate between cells with an intact membrane ...