Labshake search
Citations for Biotium Inc. :
1651 - 1700 of 1841 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 4 μl of the digested DNA was mixed with 2 μl 1:100 in DMSO diluted GelRed™ (Biotium) dye and loaded onto a 1% agarose gel and as a ladder the 100 bp plus DNA ladder from VWR was used ...
-
bioRxiv - Cell Biology 2020Quote: ... All cells were treated with Hoeschst (Biotium, USA, #40045) for 15 minutes and then washed three times with PBS ...
-
bioRxiv - Biochemistry 2020Quote: ... BRET signals were recorded from microsomes (each ∼10 µg) in the presence of 5 µM coelenterazine (Biotium Corp.) using the Cytation 5 image reader (BioTek Instruments) ...
-
bioRxiv - Immunology 2020Quote: ... Stained cells were fixed in PBS containing 1% paraformaldehyde (Biotium) and stored at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... The cover-slips were rinsed with PBSNG (3×20 min) and incubated with highly cross-absorbed donkey secondary antibodies conjugated to CF™488/594/647-Dye (1:400; Biotium, #20014 ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were then run on a 1% agarose gel and visualised using GelRed Nucleic Acid Gel Stain (Biotium). Only well separated bands corresponding to the main PCR products obtained were cut out from the gel and PCR products were extracted from gel slices using GenElute Agarose Spin Columns (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: Hoechst 3334 and Calcein-AM were all purchased from Biotium and applied using the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 500 nL (50 nl/minute) of CF568-conjugated cholera toxin B (CF568 conjugated CTB; Biotium, Fremont, CA) into PB unilaterally (right side) ...
-
bioRxiv - Neuroscience 2020Quote: Retinal sections immunolabeled with α-Rb MCT2 primary antibody were incubated with TrueBlack Lipofuscin Autofluorescence Quencher (Biotium) for thirty minutes after blocking and before primary antibody incubation ...
-
bioRxiv - Bioengineering 2020Quote: ... samples were stained with GelRed (Biotium Inc.) at 3.3× concentration and incubated at room temperature for 30 min ...
-
bioRxiv - Bioengineering 2020Quote: ... the sample was stained by GelRed (Biotium Inc.) at 1× concentration (3.3×GelRed for total RNA related detection ...
-
bioRxiv - Bioengineering 2020Quote: ... After mixing with GelRed (Biotium Inc.) at 1×concentration and 2 μl 6× blue loading dye ...
-
bioRxiv - Bioengineering 2020Quote: ... GelRed (Biotium Inc.) at 1×concentration was added to the detection samples before loading to the 0.8% agarose gel ...
-
bioRxiv - Genomics 2020Quote: ... using 22.5 uL PCR2 product in a 50 uL reaction volume (Q5 UltraII mastermix with EvaGreen (Biotium), Ta=66 ...
-
bioRxiv - Cell Biology 2020Quote: ... with EverBrite Mounting Medium with DAPI (Biotium 23002) and sealed with CoverGrip Coverslip Sealant (Biotium 23005) ...
-
bioRxiv - Cell Biology 2020Quote: ... and sealed with CoverGrip Coverslip Sealant (Biotium 23005). Epifluorescent images were acquired with a Zeiss AxioObserver Z1 or a Zeiss AxioObserver M2 microscope with a 63x Plan-Apochromat 1.4 NA oil objective and Zen Blue 2.3 software ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were treated with 5 μmol/L NucView™ 488 caspase-3 substrate (Biotium). Images were obtained in phase contrast and fluorescence mode using a x10 objective and an IncuCyte FLR time-lapse fluorescence microscope (Essen Bioscience) ...
-
bioRxiv - Cell Biology 2020Quote: ... ethidium homodimer (necrotic cells) (Biotium, Inc), and Draq5 (nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... samples were passively incubated for 48 hours at room temperature in eFLASH sample buffer.32 Rapid 24 hour immunostaining of whole hemispheres with polyclonal CF640R rabbit anti-RFP (Biotium, Fremont, CA) was carried out using the eFLASH protocol.32 The samples were again passively washed in PBSN three times for a minimum of 12 hours each before refractive index matching.
-
bioRxiv - Cancer Biology 2020Quote: C8-D1A cells were stained with the green fluorescent probe neuro-DiO (Biotium) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... CF405S anti-guinea pig (1:500, Biotium, 20356), Alexa 488nm anti-rabbit (1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... individual imaging chambers were sealed using CoverGrip sealant (Biotium, Fremont, CA).
-
bioRxiv - Biochemistry 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) was purchased from Biotium, CA ...
-
Proteasomal degradation of human SERINC4: a potent host anti-HIV-1 factor that is antagonized by NefbioRxiv - Microbiology 2020Quote: ... cells were lysed and intracellular luciferase activities were determined using Firefly Luciferase Assay Kit 2.0 (Biotium). These luciferase activities were used to calculate viral infectivity.
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... WGA CF405S conjugate (Biotium, 29027, 100 μg/mL), and phalloidin (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... and the RT-PCR products were analysed by standard agarose gel electrophoresis visualized by GelRed Nucleic Acid Stain (Biotium) and subjected to Sanger sequencing (core facility of the Haartman Institute ...
-
bioRxiv - Microbiology 2020Quote: ... The gel was stained with GelRed nucleic acid staining solution (Biotium) for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was then amplified in the presence of 0.225mM amino-allyl-dUTP (Biotium) using Taq DNA polymerase (New England Biolabs) ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were stained with 1/1000 dilution of CellBrite Fix 640 (Biotium). Cells were measured using Fiji software (Schindelin et al. ...
-
bioRxiv - Microbiology 2020Quote: ... Luciferase activity was measured with Steady-Luc luciferin (Biotium) on a multimode plate reader (PerkinElmer).
-
bioRxiv - Molecular Biology 2020Quote: ... 20× in water (Biotium, Fremont, CA, USA), 0.5 µL of 10 µM 5× WGS_Pr_R1-5’ primer (AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTC ...
-
bioRxiv - Immunology 2020Quote: ... At harvest samples were treated with Live-or-Dye™ Fixable Viability Stain (Biotium) at a 1:1000 dilution in PBS/1% FBS for 30 minutes ...
-
bioRxiv - Immunology 2020Quote: ... and Alexa Fluor 647 Tyramide (Biotium). For double staining CD301b+ DCs and B cells ...
-
bioRxiv - Immunology 2020Quote: ... The HRP-conjugated secondary antibody and streptavidin were detected by Alexa Fluor 488 Tyramide (Biotium). The sections were then incubated with 2.5 μg/ml anti-PNAd (clone MECA79 ...
-
bioRxiv - Immunology 2020Quote: ... was used to detect the anti-CD301b and anti-CD207 mAbs and HRP-conjugated streptavidin (SA-HRP, Biotium) was used to detect the biotinylated anti-CD11c mAb ...
-
bioRxiv - Immunology 2020Quote: ... medium was removed and cells were lysed in Passive lysis buffer (Biotium). Luciferin substrate (Xenogen ...
-
bioRxiv - Neuroscience 2020Quote: Goat anti-mouse IgG1 (Biotium, 1:2000) – CF405S
-
bioRxiv - Developmental Biology 2020Quote: ... separated on a 1% agarose gel and visualized with GelRed nucleic acid stain (cat #41001, Biotium, Fremont, CA) using a Syngene G:Box Chemi imager (Syngene ...
-
bioRxiv - Genetics 2020Quote: ... and we assessed DNA quality and quantity via gel electrophoresis (1.5% agarose in TAE stained with GelRed® [Biotium]) alongside a 10 kb ladder (Thermo Fisher Scientific GeneRuler™ DNA Ladder Mix #SM0334) ...
-
bioRxiv - Biophysics 2020Quote: ... 200 nM MitoView-Green (Biotium 70054) diluted in PBS was added to each well and left to incubate for 2 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... F-actin was counterstained with Phalloidin-CF405 (Biotium) for 30 min at a dilution of 1:30 ...
-
bioRxiv - Cell Biology 2019Quote: ... donkey anti-rat IgG (H+L) CF568 (Biotium, # 20092), donkey anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2019Quote: ... and CF568-conjugated Phalloidin (1:200, Cat#00044, Biotium) in PBSBT for 2 h in the hydrophobic ring.
-
bioRxiv - Microbiology 2019Quote: ... Gel electrophoreses of PCR products were done using 1% Agarose gel matrix with the addition of 10,000X GelRed™ Nucleic Acid Gel Stain (Biotium, Inc. CA, USA). Samples were run alongside 100bp exACTGene™ DNA ladder (Fisher BioReagents™ ...
-
bioRxiv - Microbiology 2019Quote: ... we used 1% GelRed stain from Biotium (Fremont, CA) with a 2.5% agarose gel and a 20 bp molecular ruler from Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... The Live-Dye Yeast Stain (#31062 Biotium Fremont, CA) protocol was performed as described by manufacturer ...
-
bioRxiv - Biophysics 2019Quote: ... pH 8.5) with 0.01% v/v GelRed (Biotium, cat# 41003), and the product amount was quantified using gel densitometry in the FIJI image processing software package(Schindelin et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2016) using 40 μl (∼40 μg) total RNA and 4 μg MTSEA biotin-XX (Biotium) in the following reaction ...
-
bioRxiv - Immunology 2019Quote: ... using an AccuBlue Broad Range kit (Biotium). Then ...
-
bioRxiv - Microbiology 2019Quote: ... The final products were purified using AMPure XP SPRI beads and quantified on a plate reader using an AccuClear DNA quantification kit (Biotium, Fremont, USA) followed by equimolar pooling ...