Labshake search
Citations for VWR :
51 - 100 of 129 citations for hsa mir 635 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... membranes were washed in 1x TBS-T and incubated for 1 hour at RT in the dark with species-specific secondary antibodies (Rb-680; 926-68071; Ms-800 926-32212) (VWR) at 1:10,000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... incubated on ice in 96-well PCR plates (VWR) for 30 min and then heat-shocked for 1 min at 42 °C in a BioRad T100 Thermal cycler ...
-
bioRxiv - Biophysics 2021Quote: ... in a 384-well PCR microplate (VWR, 10011-194), with a final volume of 15 μL per well ...
-
bioRxiv - Synthetic Biology 2020Quote: ... in RNase-free 0.2 ml PCR tubes (VWR International) or 1.5 ml DNA LoBind tubes (Eppendorf) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR was performed with the kit TaqPolimerase 2X (VWR) using the following PCR program ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR bands were visualized on 2% agarose (VWR, 97062) in TBE (VWR ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was then mixed with gene-specific primers (2 μM) and Perfecta SYBR green SuperMix reagent (Cat # MP9505402K, VWR, Radnor, PA) for PCR amplification using a DNA Engine Opticon 2 system (MJ Research ...
-
bioRxiv - Physiology 2019Quote: ... Paraffin-embedded tissue sections were then sectioned at 100 μm intervals using a Leica RM2125 RTS microtome and collected onto 76 x 26 mm StarFrost slides (VWR, UK). The slides were baked at 37°C overnight before Hemotoxylin and Eosin (H&E ...
-
bioRxiv - Bioengineering 2021Quote: ... Stained tissue sections were washed in 0.1% Triton-X/PBS at RT for 1 hour and mounted on a poly-L-lysine coated coverglass (VWR, 48393-241) for imaging (Fig ...
-
The effects of caloric restriction on adipose tissue and metabolic health are sex- and age-dependentbioRxiv - Physiology 2023Quote: ... Paraffin-embedded tissue sections were then sectioned at 100 µm intervals using a Leica RM2125 RTS microtome and collected onto 76 x 26 mm StarFrost 624 slides (VWR, UK). The slides were baked at 37°C overnight before Haematoxylin and Eosin (H&E ...
-
bioRxiv - Biophysics 2023Quote: ... and 1%(v/v) ammonium persulfate (APS) for 60 minutes at RT on plasma cleaned glass cover slips (No.1, 25mm Ø, VWR) that were pre-treated with 3-aminoproyltriethoxysiliane (APTES ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 0.4 μl of each primer and 5 μL VWR Red Taq DNA polymerase Master mix (VWR Chemicals, Denmark, Cas nr: 733-2547). The PCR reaction conditions for amplification of DNA were as follows ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Reactions were incubated in a nuclease-free PCR tube (VWR) in a ThermalCycler (C1000 Touch ...
-
bioRxiv - Microbiology 2023Quote: ... each amplicon was PCR amplified using the RedTaq polymerase (VWR) and cloned in the plasmid pCR2.1 using the TOPO-TA CloningTM Kit (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... Agar overlay lawns for passages were prepared by aliquoting 100 ul of host overnight culture (4ml 2216MB, colony inoculum from streak on 2216MB with 1.5% Bacto Agar, shaken overnight at RT at 250rpm on VWR DS500E orbital shaker) onto a standard size bottom agar plate and adding 2.5 ml of molten 52°C top agar as in the bait assay ...
-
bioRxiv - Neuroscience 2020Quote: ... immersed in 1x PBS at RT for 30 seconds and transferred to 25% Optimal Cutting Temperature compound (OCT, TissueTek; VWR 25608-930), followed by 50% OCT and then embedded in 100% OCT and placed in a cryomold ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Each fin bud was first homogenized in 50 μL of Buffer RLT (supplemented with β-mercaptoethanol per kit recommendation) for 1 min at RT in a 1.5 mL centrifuge tube using a cordless motor (VWR Catalog # 47747-370) and pestle (USA Scientific Catalog # 1415-5390) ...
-
bioRxiv - Cell Biology 2023Quote: ... The stained tissue sections were washed in 0.1% Triton-X/PBS at RT for 1 hour and finally mounted on poly-L-lysine coated cover glasses (VWR, 48393-241) for triple-view line confocal super-resolution imaging20.
-
bioRxiv - Cell Biology 2019Quote: ... genomic DNA was prepared using DirectCell-PCR Lysis-Reagent Cell (VWR) according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted with direct PCR Lysis Reagent Cell (VWR). RNA isolation was performed using the AMBION PureLink RNA Mini kit (Themo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... were added to the wells of 96-well PCR plates (VWR) in a final volume of 25 μl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... attached to an autoclaved 1.2 ml 96-well PCR plate (VWR). We centrifuged the samples in the filter plates together with the collection plates for 15 min at 2,500 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... reconciled into a clear 96-well PCR plate (VWR #76402-848), and sealed with adhesive plate tape ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 µL PCR grade nuclease-free water (VWR, Radnor, PA) were combined ...
-
bioRxiv - Cell Biology 2024Quote: Genomic DNA was extracted using Direct PCR Lysis Reagent Cell (VWR). RNA was extracted using the AMBION PureLink RNA Mini Kit (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... The suspension was allowed to cool at room temperature (RT) for 10 min before adding 1 µl RNAse at 10 mg/ml (VWR cat no. 0675-250MG) and incubation at 37 for 60 min ...
-
bioRxiv - Genetics 2021Quote: ... Resulting PCR products were loaded on a 2% agarose (VWR, 97062-250) gel ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were visualized via gel electrophoresis using peqGREEN from (VWR, Germany). As size standard ...
-
bioRxiv - Cell Biology 2020Quote: ... The Brilliant II SYBR Green QRT-PCR 1-Step Master Mix (VWR) was used to convert RNA to cDNA and amplify specific RNA regions on the CFX96 Touch real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Physiology 2022Quote: ... qRT-PCR analysis was performed using SYBR Green qPCR Master Mix (VWR). Primers were designed for gene specificity and to cross exon-exon junctions using Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Zoology 2022Quote: ... purified using ExoCleanUp FAST PCR clean-up reagent (VWR Life Sciences USA), sequenced at the forward direction in outsourcing at StabVida (Portugal ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were amplified with a peqSTAR thermocycler (VWR, Radnor, PA, USA) and the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Microbiology 2022Quote: ... The sample mixture was then transferred into an optically-clear PCR tube (VWR). SYPRO orange fluorescence data in relative fluorescence unit (RFU ...
-
bioRxiv - Biochemistry 2022Quote: ... The sample mixture was then transferred into an optically clear PCR tube (VWR). SYPRO orange fluorescence data in relative fluorescence unit (RFU ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were cloned into the pTS018 entry vector via Gibson assembly (VWR). The gRNA scaffold was amplified from pSL001 with primers P3 and P4 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with Red Taq DNA Polymerase Master Mix (VWR Life Science) according to the manufacturer’s instructions and purified with magnetic beads (CleanNGS) ...
-
bioRxiv - Biophysics 2023Quote: ... the top and bottom strand were annealed using a PCR machine (Doppio, VWR®-thermocyclerseries ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were carried out in 0.2 ml clear PCR tubes (VWR, Philadelphia, PA), and the cycling conditions were ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were separated by agarose gel electrophoresis using 1.5% agarose (VWR, 0710) in 1X TBE buffer at 150V.
-
bioRxiv - Synthetic Biology 2023Quote: ... All reactions were incubated in a 96 PCR well plate (VWR #47744-116). Surrounding wells were filled with 1x phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were analysed on a 1-2 % agarose gel (VWR, #732-2789P) prepared in 1X TAE buffer (VWR ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Karyotyping PCRs were conducted using RedTaq DNA Polymerase 2X Master Mix (VWR Life Science) with the following published primers ...
-
Autism genes converge on microtubule biology and RNA-binding proteins during excitatory neurogenesisbioRxiv - Systems Biology 2024Quote: ... All PCR reactions were conducted using KAPA Hotstart HiFi ReadMix (VWR, Cat#103568-584) with annealing temperature at 62°C (15 sec ...
-
bioRxiv - Microbiology 2021Quote: ... Each 20 μL PCR reaction was prepared with 9 μL 5Prime HotMaster Mix (VWR International), 1 μL forward primer (10 μM) ...
-
bioRxiv - Systems Biology 2022Quote: ... paired gRNA entry vectors were created by PCR amplification (Red Taq DNA Polymerase Master Mix, VWR Life Science or iProof High-Fidelity DNA Polymerase ...
-
bioRxiv - Molecular Biology 2019Quote: ... Double-stranded PCR products were visualized under UV light using a Genoplex Imager (VWR, Darmstadt, DE).
-
bioRxiv - Microbiology 2021Quote: ... PCR products were loaded on a 1% agarose gel and stained with EZ-Vision® (VWR). Images were taken using the GelDoc system (Bio-Rad).
-
bioRxiv - Molecular Biology 2019Quote: ... Double-stranded PCR products were visualized under UV light using a Genoplex Imager (VWR, Darmstadt, DE). After confirmation of occurrence and correct band sizes corresponding to PCR products (45 µl ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR was performed using the PerfecCTa SYBR Green FastMix (VWR, catalog # 101414-280) on the Step-One Plus Real-Time PCR system (Applied Biosystems ...