Labshake search
Citations for VWR :
101 - 150 of 276 citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... genomic DNA was prepared using DirectCell-PCR Lysis-Reagent Cell (VWR) according to the manufacturer’s protocol and screened by PCR using a FailSafe™ PCR kit (Buffer E ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted with direct PCR Lysis Reagent Cell (VWR). RNA isolation was performed using the AMBION PureLink RNA Mini kit (Themo Fisher ...
-
bioRxiv - Biochemistry 2020Quote: ... were added to the wells of 96-well PCR plates (VWR) in a final volume of 25 μl ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... attached to an autoclaved 1.2 ml 96-well PCR plate (VWR). We centrifuged the samples in the filter plates together with the collection plates for 15 min at 2,500 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... reconciled into a clear 96-well PCR plate (VWR #76402-848), and sealed with adhesive plate tape ...
-
bioRxiv - Microbiology 2024Quote: ... and 10 µL PCR grade nuclease-free water (VWR, Radnor, PA) were combined ...
-
bioRxiv - Cell Biology 2024Quote: Genomic DNA was extracted using Direct PCR Lysis Reagent Cell (VWR). RNA was extracted using the AMBION PureLink RNA Mini Kit (Thermo Fisher ...
-
bioRxiv - Bioengineering 2022Quote: ... Devices were washed three more times with PBS and blocked in PBS 5% bovine serum albumin (BSA, VWR) overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... The suspension was allowed to cool at room temperature (RT) for 10 min before adding 1 µl RNAse at 10 mg/ml (VWR cat no. 0675-250MG) and incubation at 37 for 60 min ...
-
bioRxiv - Genetics 2021Quote: ... Resulting PCR products were loaded on a 2% agarose (VWR, 97062-250) gel ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR products were visualized via gel electrophoresis using peqGREEN from (VWR, Germany). As size standard ...
-
bioRxiv - Cell Biology 2020Quote: ... The Brilliant II SYBR Green QRT-PCR 1-Step Master Mix (VWR) was used to convert RNA to cDNA and amplify specific RNA regions on the CFX96 Touch real-time PCR detection system (Bio-Rad) ...
-
bioRxiv - Physiology 2022Quote: ... qRT-PCR analysis was performed using SYBR Green qPCR Master Mix (VWR). Primers were designed for gene specificity and to cross exon-exon junctions using Primer-BLAST (www.ncbi.nlm.nih.gov/tools/primer-blast/ ...
-
bioRxiv - Zoology 2022Quote: ... purified using ExoCleanUp FAST PCR clean-up reagent (VWR Life Sciences USA), sequenced at the forward direction in outsourcing at StabVida (Portugal ...
-
bioRxiv - Microbiology 2024Quote: ... PCR products were amplified with a peqSTAR thermocycler (VWR, Radnor, PA, USA) and the following conditions ...
-
bioRxiv - Biophysics 2019Quote: ... four times BRB40 buffer (40 mM Pipes [Sigma], pH 6.84, with KOH [VWR], 1mM EGTA [Sigma], 4mM MgCl2 [VWR]) to remove excess F-127 in solution and exchange buffers ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell supernatants were collected at different time points and centrifuged 30min at 10,000 × g at 4°C to eliminate cell debris (centrifuge CT15RE, VWR), then at 100,000 × g for 3h to eliminate larger vesicles (L7-55 Ultracentrifuge ...
-
bioRxiv - Immunology 2022Quote: ... The protein fraction was isolated by combining four times the volume of ice cold acetone (VWR Chemicals, PA, USA) to one volume of reconstituted PBMCsec ...
-
bioRxiv - Biophysics 2019Quote: ... cells were washed three times with PBS and treated for 10 minutes with 10 mM Tris (pH 7.3, JT4109-02, VWR). Cells were then rinsed three times with PBS and permeabilized with blocking buffer (3% bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2023Quote: ... the 48 and 96 hour time points were further incubated with BMDM media containing 100 ug/mL Gentamycin (VWR) until 6 hours post infection ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was washed 3 times in PBS before blocking for 30 minutes room temperature with PBS+0.1% Triton X-100 (VWR) with 5% donkey serum (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2024Quote: Bacterial load in faeces was determined using approximately 500 µL of frozen faecal slurry (238 – 816 mg) and diluting it 400,000 times in physiological solution (8.5 g/L NaCl; VWR International). Next ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were then washed 5 times in PBS before addition of 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) substrate (VWR), and incubation at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... either unsterilized or autoclaved three times for 30 minutes) was added to a sterile 2.0 mL microcentrifuge tube (VWR), along with 1 mL of corresponding corrinoid solution for each sample ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Microbiology 2022Quote: ... The sample mixture was then transferred into an optically-clear PCR tube (VWR). SYPRO orange fluorescence data in relative fluorescence unit (RFU ...
-
bioRxiv - Biochemistry 2022Quote: ... The sample mixture was then transferred into an optically clear PCR tube (VWR). SYPRO orange fluorescence data in relative fluorescence unit (RFU ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were cloned into the pTS018 entry vector via Gibson assembly (VWR). The gRNA scaffold was amplified from pSL001 with primers P3 and P4 ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR was performed with Red Taq DNA Polymerase Master Mix (VWR Life Science) according to the manufacturer’s instructions and purified with magnetic beads (CleanNGS) ...
-
bioRxiv - Biophysics 2023Quote: ... the top and bottom strand were annealed using a PCR machine (Doppio, VWR®-thermocyclerseries ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were carried out in 0.2 ml clear PCR tubes (VWR, Philadelphia, PA), and the cycling conditions were ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR products were separated by agarose gel electrophoresis using 1.5% agarose (VWR, 0710) in 1X TBE buffer at 150V.
-
bioRxiv - Synthetic Biology 2023Quote: ... All reactions were incubated in a 96 PCR well plate (VWR #47744-116). Surrounding wells were filled with 1x phosphate-buffered saline (PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were analysed on a 1-2 % agarose gel (VWR, #732-2789P) prepared in 1X TAE buffer (VWR ...
-
bioRxiv - Microbiology 2020Quote: ... concentrated OMVs were diluted 4 times in dH2O and 5 μL of this dilution was added to 150 μL Bradford reagent (VWR). Absorbance was measured at 595 nm and compared to a standard curve to calculate protein concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... Brains were washed three times in PBS-T and mounted in Mowiol mounting medium on a borosilicate glass side (number 1.5; VWR International). Primary antibodies used were ...
-
bioRxiv - Biophysics 2019Quote: ... (4) four times BRB40 buffer (40 mM Pipes [Sigma], pH 6.84, with KOH [VWR], 1mM EGTA [Sigma], 4mM MgCl2 [VWR]) to remove excess F-127 in solution and exchange buffers ...
-
bioRxiv - Microbiology 2021Quote: ... Prothrombin time was determined by mixing 100 µl pre-warmed plasma with 200 µl pre-warmed thromboplastin (VWR # 95059-802) and monitoring for visible clotting at 37 deg C.
-
bioRxiv - Bioengineering 2021Quote: ... The samples were washed three times with PBST and then incubated with 4′,6-diamidino-2-phenylindole (DAPI, 5 µg/mL in PBS) (VWR) and phalloidin (1.5 µM in DMSO ...
-
bioRxiv - Immunology 2022Quote: ... We washed the plate with PBST (Applied Cells, Inc.) five times and added 100 μl 5% BSA (VWR Life Sciences) into each well and incubated at 37°C for 90 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were washed with PBS 3 times and fixed and permeabilized with 3.7% formaldehyde and 0.3% Triton-X (VWR 80503-490) in PBS for 30 minutes at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were washed three times in 0.1M phosphate buffer and blocked with 0.1M phosphate buffer containing 10% Triton (VWR, M143-1L) and 5% normal donkey serum (Merck Millipore S30-100mL) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Figure S2) was examined at various time points by visual examination of the pupae using a stereomicroscope VisiScope SZB 200 (VWR) (Dataset S4) ...
-
bioRxiv - Plant Biology 2020Quote: ... the required amount of biotin was added and the cell culture was transferred to the desired temperature for the required time at 130 rpm shaking in the dark in an INCLU-line IL56 (VWR) incubator ...
-
bioRxiv - Bioengineering 2021Quote: ... well plates were washed two times with MilliQ H2O and then stained with 400 μL of 2% w/V alizarin red S (VWR) for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... Brains were washed three times in PBS-T and mounted in Mowiol mounting medium on a borosilicate glass side (number 1.5; VWR International). For the Nrx-IV antibody ...
-
bioRxiv - Immunology 2022Quote: ... We washed the plate with PBST (Applied Cells, Inc.) five times and added 100 μl 5% BSA (VWR Life Sciences) into each well and incubated at 37°C for 90 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... Excess streptavidin was washed out three times by pelleting nanovials at 2000xg for 30 seconds on a Galaxy MiniStar centrifuge (VWR), removing supernatant and adding 1 mL of fresh Washing Buffer.
-
bioRxiv - Microbiology 2023Quote: ... 50 µL of the culture were transferred in a sterile tube at selected time point and inoculated on MH agar plate using easySpiral Spiral plater system (VWR). The survivors were counted after an overnight culture ...
-
bioRxiv - Bioengineering 2023Quote: ... Excess streptavidin was washed out three times by pelleting nanovials at 2000xg for 30 seconds on a Galaxy MiniStar centrifuge (VWR), removing supernatant and adding 1 mL of fresh Washing Buffer.