Labshake search
Citations for VWR :
251 - 300 of 335 citations for CKLF Like MARVEL Transmembrane Domain Containing 7 CMTM7 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 1.2 × 105 cells were plated with 10% FBS-containing NMGF media into a glass-viewing area of confocal dish (VWR, 75856-740). The next day ...
-
bioRxiv - Cell Biology 2021Quote: ... the eye cups were infiltrated with a 2:1 mixture of PBS containing 30% sucrose and OCT compound (VWR International, Radnor, PA) and frozen with dry ice ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We then transferred each of the recovered cell culture to 100 mL of molten LB (1% tryptone, 0.5% yeast extract, 1% NaCl) containing 0.3% SeaPrep agarose (VWR, Radnor, PA #12001– 922) spread into a thin layer in a 1L baffled flask (about 1 cm deep) ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of each reaction were mixed with loading dye and analyzed on a 1% (w/v) agarose gel containing GelRed (VWR, Darmstadt, Germany). The remaining PCR mix was purified using a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... One single colony was picked and incubated for 8 to 10 h at 30°C in either 4.5 ml or 1 ml BHI containing 154mM acetate in reaction tubes or Deepwell-plates (VWR International, Pennsylvania, USA), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... the flies were first sated with water and then presented with 100mM sucrose containing 2% blue dye (McCormick) filled in a graduated capillary (VWR, #53432-604). Until the flies became unresponsive to 10 serial food stimuli ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were put into 5’polystyrene chromatography columns with coarse filters (Evergreen, 208-3383-060) containing DEAE Sephadex A-25 resin (VWR, 95055-928). The columns were equilibrated in high salt buffer (20mM Tris-HCL ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then loaded into 5’polystyrene chromatography columns with coarse filters (Evergreen, 208-3383-060) containing DEAE Sephadex A-25 resin (VWR, 95055-928). Once the sample completely flowed through the column ...
-
bioRxiv - Microbiology 2023Quote: ... 1% agar [Teknova, A7777] containing 40 µg/mL Congo red dye [VWR, AAAB24310-14] and 20 µg/mL Coomassie blue dye [VWR, EM-3300]) in a 10 cm X 10 cm X 1.5 cm plates ...
-
bioRxiv - Microbiology 2023Quote: ... The AB food consisted of standard media containing 200 mg/ mL of ampicillin and kanamycin (VWR Life Science; both dissolved in water), 50 mg/ mL of tetracycline (EMD Millipore Corp. ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected into single wells (3.5 cm) of the Corning Costar 6-well cell culture plate containing HEK293T/17 cells using the JetPrime Transfection reagent (VWR, Randor, PA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... 500μl of concentrated bacterial suspension or 5% (w/v) sucrose solution (mock treatment) was added to empty fly vials containing a circular Whatman filter paper (VWR, 89013-946) on top of a foam biopsy pad (Neta Sciences ...
-
bioRxiv - Cell Biology 2022Quote: ... 400,000 cells were seeded on ethanol-sterilised coverslip in 6 well 3.5 cm diameter plate containing 22 × 22 mm glass coverslips (VWR. Cat# 631-0125). 2 μg of DNA and 6 μg of PEI were diluted in 0.25 ml of Opti-MEM™ Reduced serum medium (Gibco™) ...
-
bioRxiv - Biochemistry 2023Quote: ... Waltham, MA) containing 0.1% anticlumping agent (Thermo Fischer Scientific, Waltham, MA) in a 125 mL unbaffled shake flask (VWR, Radnor, PA, USA) with a 40 mL working volume ...
-
bioRxiv - Cell Biology 2023Quote: ... flies were then transferred to new vials containing a 1cm by 5cm strip of filter paper saturated with 300µl of 30% H2O2 (VWR, Cat# BDH7690-1) and placed at 25°C for 24 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single clones were picked from plated into 1 mL of TB media containing 100 μg/mL Ampicillin in 2 mL 96-well plates (VWR, 75870-796) and grown overnight in a 37 °C rotating shaker ...
-
bioRxiv - Biophysics 2021Quote: ... Cell culture media growth factors and antibodies were purchased from VWR International PBI (Milan ...
-
bioRxiv - Cell Biology 2023Quote: ... IRDye 800CW Goat-anti-Rabbit antibody (VWR, Cat No:102673-330) and IRDye 680RD Goat-anti-Mouse antibody (VWR ...
-
bioRxiv - Developmental Biology 2023Quote: ... incubated with the secondary antibody and DAPI (1:1000; AppliChem, VWR) for 1 h at RT and mounted with Prolong™ Gold Antifade reagent (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2024Quote: ... Rpoβ (anti-RNA polymerase beta mouse monoclonal antibody [clone: 8RB13]; VWR) was diluted 1:20,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... A maximum of 7.5% of the body weight was obtained in BD vacutainer tubes containing EDTA as anticoagulant (VWR, Ville Mont-Royal, Quebec). Adolescent mice were closely monitored for bleeding ...
-
bioRxiv - Microbiology 2022Quote: ... Supplemented M9 containing 0.85 mg/mL pluronic F127 without antibiotics was flowed via Tygon Microbore silicon tubing (VWR ND 100-80/0,508*1,524) that linked the device to a syringe pump (ALADDIN-220 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... each of which was part of a larger chamber containing 12 arenas each with a diameter of 2.54 cm (VWR cat. no. 89093-496). The bottom of each chamber contained a standard amount of either grapefruit medium or medium in which 15% of the water has been replaced with ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5% (w/v) non-fat dry milk in TRIS-buffered saline (TBS) containing 0.1% Tween-20 (TBS-T; VWR, Radnor, PA, USA, # 28829.183) for one hour at room temperature and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Genetics 2019Quote: We performed cell culture using the conditions described above in 12-well plates containing sterile 18-mm glass cover slips (VWR, Cat#48380-046). We fixed cells for 10 minutes in 4% paraformaldehyde (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Antibiotic tolerance assays using co-cultures were performed using a membrane-separated 12-well tissue plate cultures containing 0.1 μm pore PET membranes (VWR, Cat. No. 10769–226), following previously protocols (Meirelles et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... we seeded 2×104 ESCs per well of a Geltrex-coated 12-well plate for subsequent RT-PCR and RT-qPCR analyses and 1-3×103 cells per well of a 12-well plate containing a Geltrex-coated 18-mm glass coverslip (VWR, cat# 631-1580) for immunostaining ...
-
bioRxiv - Immunology 2023Quote: ... The wells were emptied and blocked with 300 µL of PBS containing 1% BSA (Bovine Serum Albumin Fraction V, VWR Cat# 97061-416) for 1 h at 25°C ...
-
bioRxiv - Genetics 2023Quote: ... with a scalpel on a cold block (Figure 1b) and resuspended on ice in 1 ml of lysis buffer containing 0.32 M Sucrose (VWR Catalog No. 97061-432), 10 mM Tris-HCl pH 8 (Invitrogen REF 15568-025) ...
-
bioRxiv - Cell Biology 2023Quote: ... and IRDye 680RD Goat-anti-Mouse antibody (VWR, Cat No:102673-408) at 1:20,000 dilutions ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... co-culture experiments were performed using membrane-separated 12-well tissue plate cultures containing 0.1 µm pore PET membranes (VWR® Cat. No. 10769-226). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Physiology 2024Quote: ... Western blot secondary antibodies included: donkey anti-rabbit HRP (VWR 95017, 1:1000) and sheep anti-mouse (GE Healthcare #NA931V ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... infrared (IR)-dye conjugate secondary antibodies IRDye 800CW Donkey Anti-Goat (VWR, #102673-336), IRDye 800CW Donkey Anti-Rabbit (VWR ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-rabbit secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-mouse secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-rabbit secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-mouse secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Developmental Biology 2020Quote: ... for blocking and with 0,2% Tween® 20 added for antibody dilutions (28829.296, VWR), washes were done with phosphate-buffered saline tween (PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Blocking buffer and primary antibody incubation solution was 5% non-fat dairy milk powder (VWR) or 5% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were detected by immunoblotting using the following primary antibody concentrations in 5% milk (VWR)/Tris Buffered Saline -Tween20 (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... and secondary antibodies were diluted to 1:10,000 (100 ng/mL) in 2.5% BSA (0332, VWR) in Tris buffered saline tween ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were incubated in a primary antibody (CD63 for the endosomal system, clone MX-49.129.5, VWR, anti-LAMP1 for lysosomes ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were probed with mouse anti-α-tubulin antibody (DM1A, VWR; #PI62204; 1:1000 in blocking buffer) for 1h at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... The labelled antibodies were dissociated from the beads by adding 15 μl 0.2M acetate (97064-482, VWR), pH 3.2 (elution buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μL of HRP-labelled Rabbit Anti-Sheep IgG (H+L) secondary antibody (VWR, Batavia, IL, USA) diluted 1:1000 (100ng/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated for 48 hr at 4°C with an antibody against RFP (1:1000, Rockland (VWR), catalog #RL600-401-379) ...
-
bioRxiv - Genomics 2019Quote: ... Western blots were performed using a mixture of mouse anti-actin antibodies (VWR catalog number 89500-294) and rabbit anti-TAP antibodies (ThermoFisher catalog number CAB1001 ...