Labshake search
Citations for VWR :
351 - 400 of 1287 citations for 7 Bromo 2 3 dihydro isoindol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures for experiments were grown in flat-bottom 3 L polycarbonate Erlenmeyer flasks (VWR, Germany) at 22-25 °C ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 l ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Bioengineering 2020Quote: ... (3) we then pipette the solutions vigorously in a 20 mL scintillation glass vial (VWR) with a hydrophobic coating which is introduced by incubation with Rain-X (ITW Global Brands ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected for five days in presence of 3 μg/ml puromycin (VWR, CAYM13884). A near 100% GFP-positive population was confirmed via microscopy (ZOE Fluorescent Cell Imager ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescence intensity (∼485 nm/∼530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR).
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine (BioWhittaker) and 10% bovine calf serum (VWR). Cos-7 cells (a gift of Dr ...
-
bioRxiv - Systems Biology 2023Quote: ... containing 2% formic acid (FA; ≥99%. VWR International, Vienna, Austria). The eluted samples were dried using a gentle nitrogen stream at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... a coverslip (VWR, No. 2, 181×8 mm, #48366-045) was coated with Poly-D-lysine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 0.5 mg/mL in PBS + 2% sucrose (VWR, #27480.294). Coverslips were placed on a piece of parafilm ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 2 μg/ml puromycin (VWR, CAYM13884) for five days and subsequently split into the different screening condition arms ...
-
bioRxiv - Immunology 2023Quote: ... The samples were stored in 2 ml ethanol (VWR, 20821.330P). Clean and fire-sterilized scissors and forceps were used for each intestinal section to minimise bacterial DNA contamination ...
-
bioRxiv - Bioengineering 2023Quote: ... and the photoabsorber 2-isopropylthioxanthone (ITX, no. TCI0678; VWR International) (0.8 w/w) ...
-
bioRxiv - Bioengineering 2024Quote: ... filtered with a 2 μm cellulose filter (VWR, #514-0061) and supplemented with 2 % fluorinated surfactant FluoSurf neat (Emulseo ...
-
bioRxiv - Cell Biology 2020Quote: NGM plates with a final concentration of 1μM auxin (indole-3-acetic acid, VWR AAA10556-36) were made according to [60] ...
-
bioRxiv - Genetics 2019Quote: ... Digested products were electrophoresed on 3% agarose gels using Agarose SFR™ (VWR Life Science, USA) for 3 hours at 80V ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel was stained with Ethidium Bromide and visualised using a Smart 3 GelDoc System (VWR).
-
bioRxiv - Cell Biology 2023Quote: ... Plates were spun and then incubated at 91°C for 3 min on heat blocks (VWR), then 60°C for 20 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 3’ end enriched libraries were constructed using KAPA HyperPlus Library Preparation Kit (VWR International, KK8513) with 6 cycles of PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were washed in PBS (3 x 5 min) and mounted on slides (Superfrost Plus, VWR) with mounting medium (Fluoromount ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sample-beads were then washed with 3 mL 75-80% ethanol (VWR Chemicals, PA, USA) and again with 2 mL 75-80% ethanol ...
-
bioRxiv - Cell Biology 2020Quote: ... with the only difference that 2 ml of mineral oil (VWR) were placed on top of the sealed prep to facilitate temperature detection with a thermocouple ...
-
bioRxiv - Microbiology 2020Quote: ... Protein syntheses were induced by 2% (wt/vol) galactose (VWR International) at 30 °C for 4 h at 250 rpm when the OD600 reached 0.8–1.0 ...
-
bioRxiv - Microbiology 2019Quote: ... To an autoclaved 2 mL microcentrifuge tube (VWR, Radnor, PA, USA), 500 µL of the supernatant was added ...
-
bioRxiv - Bioengineering 2019Quote: ... which had to be blocked in 2% (w/v) BSA (VWR) + 0,05% tween-20 in PBS to work (data not shown) ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in PBS + 2% SDS + protease inhibitor cocktail (VWR, #97063-972), and transferred to 2 mL disruption tubes (OPS Diagnostics ...
-
bioRxiv - Biophysics 2021Quote: ... 2 million cells were seeded into a 10 cm dish (VWR) and transfected with 8 μg hASIC1a WT ...
-
bioRxiv - Cancer Biology 2021Quote: ... The fixed sections were covered with propan-2-ol (VWR, 20842312). Following evaporation for 40 seconds ...
-
bioRxiv - Microbiology 2022Quote: ... The fungal specimen was sandwiched between 2 cover glasses (VWR international).
-
bioRxiv - Neuroscience 2022Quote: The brain was transferred to 2% dimethyl sulfoxide (DMSO; VWR, USA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were run on a 2% agarose (VWR, Cat# MPN605-500G) and 1X Tris-Acetate-EDTA (TAE ...
-
bioRxiv - Molecular Biology 2023Quote: ... and resuspended in 50 µl 2 M urea (VWR, 0568-500G), 50 mM ABC.
-
bioRxiv - Immunology 2023Quote: ... and resuspended in 50 µl 2 M urea (VWR, 0568-500G), 50 mM ABC ...
-
bioRxiv - Molecular Biology 2023Quote: ... slides were washed 2 times with Histochoice Clearing Agent (VWR, H103) and 4 times with isopropanol (VWR,9084-03 ...
-
bioRxiv - Cell Biology 2024Quote: ... P/S and 2% human serum (VWR/BioWest, cat. #S4190-100). The culture insert’s apical site was supplemented with 300uL and the basolateral site with 800uL media ...
-
bioRxiv - Immunology 2023Quote: ... and 2 steps at 50% with reagent alcohol (VWR BDH1156-4LP)) into water ...
-
bioRxiv - Microbiology 2024Quote: Caco-2 cells were seeded into 24-well Transwell plates (VWR) at a density of 1.5×105 cells/cm2 and grown at 37°C in 5% CO2 for 14 or 21 days for confluency ...
-
bioRxiv - Genetics 2019Quote: ... All digested products were electrophoresed on 3% agarose gels using Agarose SFR™ (VWR Life Science, USA) for 3 hours at 80V ...
-
bioRxiv - Plant Biology 2021Quote: ... 3.5 mL of 18.2 MΩ deionised water (Elga PURELAB flex 3 system, VWR International, Edmonton, AB, Canada) was then added to effect a separation into a polar methanol/water layer and a chloroform layer ...