Labshake search
Citations for VWR :
201 - 250 of 1144 citations for 7 Benzyl 2 oxa 7 aza spiro4.4nonan 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: hPSC-CMs were fixed in 2% paraformaldehyde (VWR) for 30 min at room temperature and permeabilised with 0.1% Triton-X 100 (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: ... rinsed once in PBS with 2% serum (VWR), and resuspended in a “starve media” (PBS with 10% serum) ...
-
bioRxiv - Bioengineering 2020Quote: ... Methanol and 2-propanol were provided by VWR Chemicals ...
-
bioRxiv - Biophysics 2020Quote: ... 2 hrs at room temperature (VWR rotator, VWR). The solution was completely removed ...
-
bioRxiv - Biophysics 2020Quote: ... 2 hrs at room temperature (VWR rotator, VWR). The solution was completely removed ...
-
bioRxiv - Microbiology 2022Quote: ... 2% (w/v) D-galactose (VWR, 200001-176), 300 μg/ml hygromycin (Gibco ...
-
bioRxiv - Bioengineering 2022Quote: ... and blocked with 100 µL BSA 2% (VWR) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2019Quote: ... 2% (w/w) agar (VWR, Solon, OH, USA)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 50μmol/L 2-mercaptoethanol (VWR, 97064-880). Cells were transfected with DNA constructs (1ug/well in 12-well plate ...
-
bioRxiv - Neuroscience 2021Quote: ... plus 2 mg/ml biocytin (VWR International, UK), at pH 7.25 adjusted with CsOH and 285 mOsm.
-
bioRxiv - Physiology 2022Quote: ... supplemented with 2% horse serum (defined; VWR 16777), and 0.1% penicillin-streptomycin.
-
bioRxiv - Physiology 2019Quote: ... supplemented with 2% horse serum (Defined; VWR 16777), and 0.1% penicillin-streptomycin ...
-
bioRxiv - Genomics 2020Quote: ... 2 mM CaCl2 (VWR, cat. no. 97062-820), and 42 mM MgCl2 (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% bovine serum albumin (VWR, Cat#97061-416), 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% Bovine Serum Albumin (BSA; Cat. #: 421501J, VWR), and 0.1% Triton X-100 in PBS ...
-
bioRxiv - Genomics 2024Quote: ... 2 mM CaCl2 (VWR International Ltd, 97062-820), and 42 mM MgCl2 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 glass coverslips (48368-040; VWR, Radnor, PA) were exposed to air plasma for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 2% Fetal Bovine Serum (FBS, VWR) and 10 mM HEPES buffer (Corning) ...
-
bioRxiv - Cell Biology 2019Quote: ... Single cells were sorted into 200 μL fresh culture medium in one well of a 96-well flat bottom plate (VWR Catalog #29442-054).
-
bioRxiv - Molecular Biology 2020Quote: ... or a non-specific siGENOME Non-Targeting siRNA (Pool #2, Dharmacon) were transfected into U-2 OS cells with INTERFERin™ Polyplus Reagent (VWR) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Recipient mice were maintained for 2 weeks on autoclaved food and water containing 2 mg/ml neomycin sulfate (VWR 89149–866) and 1000 U/ml polymyxin B (Millipore Sigma P4932-5MU) ...
-
bioRxiv - Microbiology 2020Quote: ... Separately sterilized 2% D-(+)-glucose monohydrated (VWR Chemicals, Germany) was added to the medium ...
-
bioRxiv - Bioengineering 2020Quote: ... and coated overnight in 2 mg/mL BSA (VWR) at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... 170 µm thickness (VWR micro cover glass No. 2), are adhered to the surface with Norland 60 Optical Adhesive and then coated in 150 nm of aluminum by Lesker physical vapor deposition (PVD) ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to a 2 mL homogenizer (VWR International). To generate synaptosomes ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine and 10% bovine calf serum (VWR) was used during live imaging processes.
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2% Proteinase K (20 mg/ml, VWR) was added per 1 g of tissue ...
-
bioRxiv - Systems Biology 2020Quote: ... supplemented with 2% Fetal Calf Serum (VWR #89510-184). After 16h ...
-
bioRxiv - Immunology 2020Quote: ... Slides were incubated in 2% sodium borohydride (VWR, BDH4604) in PBS for 40 minutes at RT to remove auto fluorescence ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed in 2% paraformaldehyde (VWR International, Inc.) to assess pan-immune cells in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL 5x SYBR green (VWR, CN 12001-796), and 1.4 µL nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: ... cleared in a solution of xylene (2 min; VWR, International ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR bands were visualized on 2% agarose (VWR, 97062) in TBE (VWR ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5% 2-mercaptoethanol (VWR Life Science #M131-100ml) and then ran on 4-20% Criterion TGX pre-cast gels (Bio-Rad #5671093) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM phenylmethylsulfonyl fluoride (VWR Life Science, Radnor, PA) and the protease inhibitor cocktail ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 2 Glass Coverslips (# 48382-085) were purchased from VWR. RNeasy mini prep kit (# 74106 ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine (BioWhittaker) and 10% bovine calf serum (VWR). Cos-7 cells (a gift of Dr ...
-
bioRxiv - Systems Biology 2023Quote: ... containing 2% formic acid (FA; ≥99%. VWR International, Vienna, Austria). The eluted samples were dried using a gentle nitrogen stream at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... a coverslip (VWR, No. 2, 181×8 mm, #48366-045) was coated with Poly-D-lysine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 0.5 mg/mL in PBS + 2% sucrose (VWR, #27480.294). Coverslips were placed on a piece of parafilm ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 2 μg/ml puromycin (VWR, CAYM13884) for five days and subsequently split into the different screening condition arms ...
-
bioRxiv - Immunology 2023Quote: ... The samples were stored in 2 ml ethanol (VWR, 20821.330P). Clean and fire-sterilized scissors and forceps were used for each intestinal section to minimise bacterial DNA contamination ...