Labshake search
Citations for VWR :
301 - 350 of 1253 citations for 6 Methyl 2 7 naphthyridin 1 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 2 glass coverslips (48368-040; VWR, Radnor, PA) were exposed to air plasma for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 2% Fetal Bovine Serum (FBS, VWR) and 10 mM HEPES buffer (Corning) ...
-
bioRxiv - Cell Biology 2019Quote: ... Single cells were sorted into 200 μL fresh culture medium in one well of a 96-well flat bottom plate (VWR Catalog #29442-054).
-
bioRxiv - Molecular Biology 2020Quote: ... or a non-specific siGENOME Non-Targeting siRNA (Pool #2, Dharmacon) were transfected into U-2 OS cells with INTERFERin™ Polyplus Reagent (VWR) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Recipient mice were maintained for 2 weeks on autoclaved food and water containing 2 mg/ml neomycin sulfate (VWR 89149–866) and 1000 U/ml polymyxin B (Millipore Sigma P4932-5MU) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3-D spheroids were generated by seeding 2.0E6 cells per well of a 6-well cell repellent plate (VWR) in a final volume of 4.0 mL complete media and placed on an orbital shaker at 95 RPM for 24 hours ...
-
bioRxiv - Bioengineering 2019Quote: ... undifferentiated hPSCs were initially seeded at 1.0 million cells/1mL in ultra-low attachment 6 well plates (Corning, VWR) placed on a 9-Position stir plate (Chemglass ...
-
bioRxiv - Cancer Biology 2020Quote: ... MSCs were plated at 1.75×105 cells per 4.2cm2 of a 6-well transwell insert (Falcon 353090, VWR, Germany).
-
bioRxiv - Neuroscience 2022Quote: ... the cell strainer was removed from the testing arena and dropped into a 6-well dish (VWR 10861-554) containing 4% PFA in 1x PBT (1x PBS + 0.25% TritonX100) ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293 Flp-in T-REx/GFP-LRRK1 cells were seeded at 2.5 x 105 cells/well in 6 well plates on glass coverslips (VWR, 631-0125 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Peak fractions were analyzed using SDS-PAGE and were further purified in a Superose 6 Increase 10/300 (VWR) using Buffer A as running buffer (free of EDTA/PMSF) ...
-
bioRxiv - Biophysics 2020Quote: Samples were vacuum dried and re-suspended in 6 µl of Buffer A (0.1% Formic acid (Roth) in MS grade water (VWR)).
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 25 min while stirring at 900 RPM (speed 4/6) on a hotplate stirrer (VWR). The digested suspension was strained through a 70-um strainer ...
-
bioRxiv - Immunology 2023Quote: ... VRE colonization levels were monitored by plating fresh stool that was serially diluted in PBS on Enterococcus selective Bile Esculin Azide Agar (BEA) media (Remel) Supplementary Fig.ed with vancomycin 6 μg/mL (VWR), erythromycin 4 μg/mL (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cultured in 150mm dish (Alkali scientific TDN0150) for protein experiment and in 6-well culture plate (VWR, 100062-892) for total RNA experiment and transfected at around 50-60% confluency ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were then washed 5 times in PBS before addition of 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) substrate (VWR), and incubation at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were typically grown in 6-well plates after placing round coverslips in the bottom of the wells (VWR), or in PhenoPlates 96-well (Perkin Elmer) ...
-
bioRxiv - Microbiology 2020Quote: ... Separately sterilized 2% D-(+)-glucose monohydrated (VWR Chemicals, Germany) was added to the medium ...
-
bioRxiv - Bioengineering 2020Quote: ... and coated overnight in 2 mg/mL BSA (VWR) at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... 170 µm thickness (VWR micro cover glass No. 2), are adhered to the surface with Norland 60 Optical Adhesive and then coated in 150 nm of aluminum by Lesker physical vapor deposition (PVD) ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to a 2 mL homogenizer (VWR International). To generate synaptosomes ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine and 10% bovine calf serum (VWR) was used during live imaging processes.
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2% Proteinase K (20 mg/ml, VWR) was added per 1 g of tissue ...
-
bioRxiv - Systems Biology 2020Quote: ... supplemented with 2% Fetal Calf Serum (VWR #89510-184). After 16h ...
-
bioRxiv - Immunology 2020Quote: ... Slides were incubated in 2% sodium borohydride (VWR, BDH4604) in PBS for 40 minutes at RT to remove auto fluorescence ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed in 2% paraformaldehyde (VWR International, Inc.) to assess pan-immune cells in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL 5x SYBR green (VWR, CN 12001-796), and 1.4 µL nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: ... cleared in a solution of xylene (2 min; VWR, International ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR bands were visualized on 2% agarose (VWR, 97062) in TBE (VWR ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5% 2-mercaptoethanol (VWR Life Science #M131-100ml) and then ran on 4-20% Criterion TGX pre-cast gels (Bio-Rad #5671093) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM phenylmethylsulfonyl fluoride (VWR Life Science, Radnor, PA) and the protease inhibitor cocktail ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 2 Glass Coverslips (# 48382-085) were purchased from VWR. RNeasy mini prep kit (# 74106 ...
-
bioRxiv - Biochemistry 2021Quote: For transductions VeroE6 or HEK cells were seeded into greiner CELLSTAR® 96-well plates or 6-well plates (VWR) containing lentivirus in DMEM containing 2 % FBS and 1 μg/mL polybrene ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 μL of the culture was inoculated into 3 mL of MSgg liquid media in a 6-well or 12-well microtiter plate (VWR). The plates were incubated at 30°C for 2-3 days ...
-
bioRxiv - Microbiology 2020Quote: ... animals were randomly assigned to individual cages under one of four groups (n=8 per group): Wild-type (WT) C57BL/6 mice with access to a free running wheel (VWR) or a locked wheel (SED) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Jag1-Fc was immobilized by overnight incubation at 4°C in individual wells of non-tissue culture-treated 6 or 12 well plates (VWR) at a final concentration of 2 µg/mL in DPBS containing 10 µg/mL poly-D-lysine (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Molecular Biology 2023Quote: Monocytes were isolated as described above and 3×106 cells/ml were plated in a 6-well plate using RPMI-1640 medium (#392-0427, VWR) supplemented with 10% FBS (#11573397 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...