Labshake search
Citations for VWR :
251 - 300 of 440 citations for 6 ETHYL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: MDCK.2 cells (ATCC) were seeded at a density of 1 × 106 cells/well in 6-well plates (VWR International) and incubated overnight at 37℃ 5% CO2 ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 µL of each was added to 2 mL cultures of attached cells in 6-well plates (#10861-554, VWR) containing 0.2 mM CaCl2 ...
-
bioRxiv - Biochemistry 2022Quote: Each <3 kDa FBS extracted material was added to >30 kDa FBS fraction in 2 mL FBS-free media in the well of a 6-well plate (#10861-554, VWR) at roughly 10X the concentration they would exist in the standard growth media ...
-
bioRxiv - Molecular Biology 2023Quote: Monocytes were isolated as described above and 3×106 cells/ml were plated in a 6-well plate using RPMI-1640 medium (#392-0427, VWR) supplemented with 10% FBS (#11573397 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Cell Biology 2020Quote: ... After 10 min of fixation using 4% neutral buffered formaldeyde (VWR, Darmstadt, Germany), the cell count was assessed by DAPI-staining (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 hours post-transfection cells were fixed in 4% paraformaldehyde (VWR, AAJ61899-AK) for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... the larvae were initially fixed by immersion in 4% paraformaldehyde (VWR:15713-S) /0.1M sodium-cacodylate (VWR:11653) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-4 μl were mounted on a SuperFrost microscope slide (VWR; 631-0847), covered with a glass cover slip (VWR ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-4 mid-sagittal sections were mounted on Superfrost Plus microscope slides (VWR) using Vectamount mounting media containing DAPI (Vector Laboratories) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed with ice cold 4 % paraformaldehyde (PFA)(43368.9M, VWR Stockholm Sweden) and for 15 min and permeabilized with 0.1 % (w/v ...
-
bioRxiv - Immunology 2022Quote: ... Human colon tissue samples were fixed in 4%(w/v) PFA (VWR International) for 24h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... Multiple 1 l cell cultures in 4 l flasks (VWR cat # 32645–044) were incubated 72 h at 27 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed (4% formaldehyde, VWR International, in PBS; 10 min. at RT), washed (2 × 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... jejunum and ileum and fixed overnight (ON) at 4°C in formalin (VWR), a 4% formaldehyde solution buffered to pH 6.9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were briefly fixed in 4% paraformaldehyde (PFA, VWR, Cat # AA-A11313-36) in phosphate buffered saline (PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were washed 4 times with 0.1% NP-40 substitute (VWR, 97064-730) in tris-buffered saline (TBS) ...
-
bioRxiv - Plant Biology 2022Quote: ... 4-day-old seedlings were placed in a 1-well chambered coverglass (VWR, Kammerdeckglä ser ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed with 4% formaldehyde stabilized with 0.5-1.5% methanol (VWR, 9713) for 12 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Equal volumes (20 μL) of the cell suspension and 4% trypan blue (VWR) were gently mixed ...
-
bioRxiv - Plant Biology 2024Quote: ... Cultures were grown under constant shaking (VWR shaker model 3500, shaker setting 4), 18°C ...
-
bioRxiv - Neuroscience 2024Quote: ... We fixed the cells with 600 µL of 4% paraformaldehyde solution (VWR International) in PBS for 15 min and washed them with PBS three times ...
-
bioRxiv - Neuroscience 2024Quote: ... and cooling to 4°C using a thermocycler (Avantor VWR, Radnor, PA, USA). All primers were originally designed using NCBI primer blast software ...
-
bioRxiv - Microbiology 2021Quote: ... and a dye photosensitizer in N,N-dimethylformamide/acetone (7/3, v/v) was electrospun onto one layer of polypropylene (PP) fabrics (VWR® Basic Protection Face Mask). During the electrospinning of 10-20 wt% of PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were plated in 6-well plates at 1 million cells per well and the following day were transfected with 2 μg DNA using 6 μl of JetPrime (VWR International) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... equal numbers of cells were counted by Moxi Mini automated cell counter (Orflo) and 0.6×10^6 cells per data point were seeded in T-25 cell culture flasks (VWR, PA, USA) in appropriate volume of culture medium ...
-
bioRxiv - Microbiology 2022Quote: ... PS01156 or both PS01155 and PS01156 (∼6*107 CFU/ml) in polypropylene conical tubes (cat. no. 89039-670, VWR, Radnor, PA) in BHI broth ...
-
bioRxiv - Molecular Biology 2023Quote: ... animals of the indicated genotype were washed out of wells on a 6-well plate at the indicated timepoints with M9+0.05% gelatin (VWR, 97062-620), transferred to a 1.5 ml tube and washed twice more with M9+0.05% gelatin ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 mM imidazole and 200 mM NaCl was added before loading on a self-packed 3 ml Ni Sepharose™ 6 Fast Flow (VWR) column using ÄKTA Pure FPLC system (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... and blocked overnight at 4 °C in PBS supplemented with 0.05% Tween-20 (VWR) and 5% (w/v ...
-
bioRxiv - Genetics 2020Quote: ... series (25% to 100%) at 4°C and stored in 100% acetone (VWR Chemicals) until critical point drying with liquid CO2 using an Emitech K850 (EM Technologies Ltd) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 ml of pre-chilled (−20°C) methanol/acetic acid (3:1, VWR chemicals) was added dropwise and flicking to homogenize ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.05% Tween-20) and incubated overnight at 4°C on a rotating mixer (VWR). A Dynabeads MPC-S Magnetic Particle Concentrator was used to collect the magnetic beads and extract the unbound material ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted 1:50 in 5 % BSA/TBST overnight at 4°C (BSA: VWR; #422361V). As a negative control ...
-
bioRxiv - Microbiology 2023Quote: Samples were analyzed using standard SDS-PAGE (4-16% bis acrylamide, Precast gels, VWR) and immunoblotting techniques ...
-
bioRxiv - Bioengineering 2023Quote: ... Mouse uterus cross-section tissue was fixed for 30 minutes in 4% formaldehyde (VWR) before blocking for 30 minutes in 10% Normal Goat Serum (50062Z ...
-
bioRxiv - Cell Biology 2019Quote: ... 2-3 × 105 single cells EpiSCs were seeded on 5 μg/10 cm2 fibronectin-coated 6-well plates in media containing (1 μl/ml) ROCK inhibitor (InSolution™ Y-276320, Cat.#688001-500UG, VWR Calbiochem). In the morning of transfection ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were plated to ∼2 x 105 cells per well in a 6-well VWR tissue culture-treated plates (VWR, Suwanee, GA) and incubated ∼12 hours (overnight) ...
-
bioRxiv - Neuroscience 2019Quote: ... with glass pipettes with open tip resistance of 3-6 MΩ (TW150F-3, World Precision Instruments, & 100µL calibrated pipettes #534332-921,VWR International). The bath solution consisted of ACSF ...
-
bioRxiv - Cancer Biology 2022Quote: Splenocytes were isolated from the spleen of 6-10-week-old OT-I male mice and pulsed with 2ug/ml of OVA peptide SIINFEKL (VWR, H-4866.0001BA) for 4 h in T cell culture media composed of RPMI1640 (GE Healthcare ...
-
bioRxiv - Developmental Biology 2023Quote: ... each organoid was cut into 6 pieces using needles and subjected to shaking culture at 120 rpm (VWR Orbital Shaker Model 1000) in KR5 medium to develop cysts ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected into single wells (3.5 cm) of the Corning Costar 6-well cell culture plate containing HEK293T/17 cells using the JetPrime Transfection reagent (VWR, Randor, PA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 400,000 cells were seeded on ethanol-sterilised coverslip in 6 well 3.5 cm diameter plate containing 22 × 22 mm glass coverslips (VWR. Cat# 631-0125). 2 μg of DNA and 6 μg of PEI were diluted in 0.25 ml of Opti-MEM™ Reduced serum medium (Gibco™) ...
-
bioRxiv - Cell Biology 2023Quote: Lyophilized liver samples were homogenized in 10 mM phosphate buffer at pH 6 (28 mg tissue per ml buffer) on a bead beater (VWR, Radnor, PA) for 1 min ...
-
bioRxiv - Microbiology 2024Quote: ... 200 µL of the bacteria were pipetted on 6 cm NGM plates and evenly spread across the agar plate using a sterile L spreader (VWR 490007-358). Bacterial plates were left to dry in a laminar flow hood for 2 days ...
-
bioRxiv - Cell Biology 2021Quote: ... the gels were washed once with PBS and then fixed with 4% paraformaldehyde (VWR, 43368) for 10 min ...