Labshake search
Citations for VWR :
601 - 650 of 650 citations for 6 CHLORO 3 METHYLPYRIDO 3 4 D PYRIMIDIN 4 3H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... MSCs were plated at 1.75×105 cells per 4.2cm2 of a 6-well transwell insert (Falcon 353090, VWR, Germany).
-
bioRxiv - Neuroscience 2022Quote: ... the cell strainer was removed from the testing arena and dropped into a 6-well dish (VWR 10861-554) containing 4% PFA in 1x PBT (1x PBS + 0.25% TritonX100) ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293 Flp-in T-REx/GFP-LRRK1 cells were seeded at 2.5 x 105 cells/well in 6 well plates on glass coverslips (VWR, 631-0125 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Peak fractions were analyzed using SDS-PAGE and were further purified in a Superose 6 Increase 10/300 (VWR) using Buffer A as running buffer (free of EDTA/PMSF) ...
-
bioRxiv - Biophysics 2020Quote: Samples were vacuum dried and re-suspended in 6 µl of Buffer A (0.1% Formic acid (Roth) in MS grade water (VWR)).
-
bioRxiv - Immunology 2023Quote: ... VRE colonization levels were monitored by plating fresh stool that was serially diluted in PBS on Enterococcus selective Bile Esculin Azide Agar (BEA) media (Remel) Supplementary Fig.ed with vancomycin 6 μg/mL (VWR), erythromycin 4 μg/mL (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cultured in 150mm dish (Alkali scientific TDN0150) for protein experiment and in 6-well culture plate (VWR, 100062-892) for total RNA experiment and transfected at around 50-60% confluency ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were typically grown in 6-well plates after placing round coverslips in the bottom of the wells (VWR), or in PhenoPlates 96-well (Perkin Elmer) ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with 1% penicillin-streptomycin and 1% FBS at a density of 250,000 cells per well in 24 well plates (Nunclon) on coverslips precoated with poly-d-lysine and Matrigel (VWR) diluted 1:200 in Minimum Essential Media (HyClone) ...
-
bioRxiv - Microbiology 2019Quote: ... Pellets were thawed on ice and resuspended in 250 μL of PBS supplemented with 1 M NaCl and 6 M Urea (VWR). The resuspended bacteria were then added to screw cap microcentrifuge lysing tubes (Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: For transductions VeroE6 or HEK cells were seeded into greiner CELLSTAR® 96-well plates or 6-well plates (VWR) containing lentivirus in DMEM containing 2 % FBS and 1 μg/mL polybrene ...
-
bioRxiv - Microbiology 2020Quote: ... animals were randomly assigned to individual cages under one of four groups (n=8 per group): Wild-type (WT) C57BL/6 mice with access to a free running wheel (VWR) or a locked wheel (SED) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then subcultured 1:1000 into 7 mL of MSgg in a 6-well polyvinyl plate (VWR, PA, USA). Plates were incubated in static conditions at 30°C for 3 days and were then imaged using a Leica MZ10F macroscope and Leica DMC2900 camera ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Microbiology 2022Quote: ... The in-house polyacrylamide TBE gels (40 ml) for horizontal electrophoresis were produced by combining 6 ml 40% Acryl/Bis 29:1 (VWR), 4 ml of 5x TBE ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Immunology 2023Quote: MDCK.2 cells (ATCC) were seeded at a density of 1 × 106 cells/well in 6-well plates (VWR International) and incubated overnight at 37℃ 5% CO2 ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 µL of each was added to 2 mL cultures of attached cells in 6-well plates (#10861-554, VWR) containing 0.2 mM CaCl2 ...
-
bioRxiv - Biochemistry 2022Quote: Each <3 kDa FBS extracted material was added to >30 kDa FBS fraction in 2 mL FBS-free media in the well of a 6-well plate (#10861-554, VWR) at roughly 10X the concentration they would exist in the standard growth media ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2020Quote: ... either D-luciferin (Fisher #LUCK-2G; 150 µg / mL read concentration) or Rluc substrate (VWR # PAP1232; 17 µM read concentration). Maximum cytotoxicity was defined as luminescent signal from wells containing only media while no cytotoxicity was defined by wells containing only target cells ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells on D-poly-Lysine coated coverslips were then fixed with pre-warmed 3.7% formaldehyde (v/v; VWR, VW3408-1), permeabilized with ice-cold methanol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0.5 - 1 million gated events were collected into a 15 mL conical tube with 5 mL of LB supplemented with 1 % D-Glucose (10117, VWR) and without antibiotics ...
-
bioRxiv - Genomics 2022Quote: ... after attaching of the tissue section to the slide surface containing 100% poly-d(T) capture probes the tissue was fixed in methanol (VWR) at -20°C for 40 minutes and stained with 0.05% Toluidine Blue (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were plated in 6-well plates at 1 million cells per well and the following day were transfected with 2 μg DNA using 6 μl of JetPrime (VWR International) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... equal numbers of cells were counted by Moxi Mini automated cell counter (Orflo) and 0.6×10^6 cells per data point were seeded in T-25 cell culture flasks (VWR, PA, USA) in appropriate volume of culture medium ...
-
bioRxiv - Microbiology 2022Quote: ... PS01156 or both PS01155 and PS01156 (∼6*107 CFU/ml) in polypropylene conical tubes (cat. no. 89039-670, VWR, Radnor, PA) in BHI broth ...
-
bioRxiv - Molecular Biology 2023Quote: ... animals of the indicated genotype were washed out of wells on a 6-well plate at the indicated timepoints with M9+0.05% gelatin (VWR, 97062-620), transferred to a 1.5 ml tube and washed twice more with M9+0.05% gelatin ...
-
bioRxiv - Cell Biology 2019Quote: ... 2-3 × 105 single cells EpiSCs were seeded on 5 μg/10 cm2 fibronectin-coated 6-well plates in media containing (1 μl/ml) ROCK inhibitor (InSolution™ Y-276320, Cat.#688001-500UG, VWR Calbiochem). In the morning of transfection ...
-
bioRxiv - Bioengineering 2021Quote: ... The cells were plated to ∼2 x 105 cells per well in a 6-well VWR tissue culture-treated plates (VWR, Suwanee, GA) and incubated ∼12 hours (overnight) ...
-
bioRxiv - Cancer Biology 2022Quote: Splenocytes were isolated from the spleen of 6-10-week-old OT-I male mice and pulsed with 2ug/ml of OVA peptide SIINFEKL (VWR, H-4866.0001BA) for 4 h in T cell culture media composed of RPMI1640 (GE Healthcare ...
-
bioRxiv - Developmental Biology 2023Quote: ... each organoid was cut into 6 pieces using needles and subjected to shaking culture at 120 rpm (VWR Orbital Shaker Model 1000) in KR5 medium to develop cysts ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected into single wells (3.5 cm) of the Corning Costar 6-well cell culture plate containing HEK293T/17 cells using the JetPrime Transfection reagent (VWR, Randor, PA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 400,000 cells were seeded on ethanol-sterilised coverslip in 6 well 3.5 cm diameter plate containing 22 × 22 mm glass coverslips (VWR. Cat# 631-0125). 2 μg of DNA and 6 μg of PEI were diluted in 0.25 ml of Opti-MEM™ Reduced serum medium (Gibco™) ...
-
bioRxiv - Cell Biology 2023Quote: Lyophilized liver samples were homogenized in 10 mM phosphate buffer at pH 6 (28 mg tissue per ml buffer) on a bead beater (VWR, Radnor, PA) for 1 min ...
-
bioRxiv - Microbiology 2024Quote: ... 200 µL of the bacteria were pipetted on 6 cm NGM plates and evenly spread across the agar plate using a sterile L spreader (VWR 490007-358). Bacterial plates were left to dry in a laminar flow hood for 2 days ...
-
bioRxiv - Biochemistry 2019Quote: ... both supplemented with 10 μg/mL chloramphenicol (Cm) and 10 μM (mild induction) or 100 μM (strong induction) of isopropyl β-D-1-thiogalactopyranoside (IPTG) (43714 5X, VWR Chemicals) when necessary.
-
bioRxiv - Plant Biology 2024Quote: ... the root tips were dissected in excess of water on a glass slide using a razorblade and positioned in the centre of a Corning® BioCoat™ Poly-D-Lysine Glass Coverslip 12 mm (VWR) in 5 µL of water ...
-
bioRxiv - Microbiology 2021Quote: GC-376 (CAS: 1416992-39-6) was purchased from Enovation chemicals (Green book, NY) and dissolved in deionized water (HyClone, VWR, West Chester, PA) to the desired concentration.
-
bioRxiv - Genomics 2022Quote: ... HeLa S3 or HeLa S3 + TOP2A- Venus cell linescells were either grown or spun onto 22×22mm No 1.5 coverslips in 6-well plates (VWR Cat No 48366-277). (cell cycle analysis experiments ...
-
bioRxiv - Biophysics 2024Quote: ... 293T/17 cells were plated in complete DMEM at 8 × 105 cells per well in a 6-well plate with an autoclaved glass coverslip (VWR, no. CLS-1760-025) to ensure 80% confluency on the day of the experiment ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then incubated with 250 nM TG or 10 µM monensin in fresh medium for 0.5 h at 37°C before 40 µM D-biotin (VWR Life Science, Radnor, PA) was added ...
-
bioRxiv - Immunology 2024Quote: ... at a concentration of 1x105 neurons/ml so that 1x105 neurons were seeded onto poly-D-lysine (10 µg/mL) coated acid-etched coverslips (VWR,, cat#MSPP-P06G1520F) and cultured at 37°C plus 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... Six to seven grams (6 ml) of soil was transferred to each well of the 12-well microtiter plates (VWR American cat no.:10861-556, USA), containing three one-millimeter holes in the bottom of all wells for drainage ...