Labshake search
Citations for VWR :
551 - 600 of 1600 citations for 6 CHLORO 2 3 4 9 TETRAHYDRO 1H CARBAZOL 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... supplemented with 2% Fetal Calf Serum (VWR #89510-184). After 16h ...
-
bioRxiv - Immunology 2020Quote: ... Slides were incubated in 2% sodium borohydride (VWR, BDH4604) in PBS for 40 minutes at RT to remove auto fluorescence ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed in 2% paraformaldehyde (VWR International, Inc.) to assess pan-immune cells in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL 5x SYBR green (VWR, CN 12001-796), and 1.4 µL nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: ... cleared in a solution of xylene (2 min; VWR, International ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR bands were visualized on 2% agarose (VWR, 97062) in TBE (VWR ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5% 2-mercaptoethanol (VWR Life Science #M131-100ml) and then ran on 4-20% Criterion TGX pre-cast gels (Bio-Rad #5671093) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM phenylmethylsulfonyl fluoride (VWR Life Science, Radnor, PA) and the protease inhibitor cocktail ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 2 Glass Coverslips (# 48382-085) were purchased from VWR. RNeasy mini prep kit (# 74106 ...
-
bioRxiv - Biochemistry 2021Quote: For transductions VeroE6 or HEK cells were seeded into greiner CELLSTAR® 96-well plates or 6-well plates (VWR) containing lentivirus in DMEM containing 2 % FBS and 1 μg/mL polybrene ...
-
bioRxiv - Microbiology 2020Quote: ... animals were randomly assigned to individual cages under one of four groups (n=8 per group): Wild-type (WT) C57BL/6 mice with access to a free running wheel (VWR) or a locked wheel (SED) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures for experiments were grown in flat-bottom 3 L polycarbonate Erlenmeyer flasks (VWR, Germany) at 22-25 °C ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 l ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Bioengineering 2020Quote: ... (3) we then pipette the solutions vigorously in a 20 mL scintillation glass vial (VWR) with a hydrophobic coating which is introduced by incubation with Rain-X (ITW Global Brands ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected for five days in presence of 3 μg/ml puromycin (VWR, CAYM13884). A near 100% GFP-positive population was confirmed via microscopy (ZOE Fluorescent Cell Imager ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescence intensity (∼485 nm/∼530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR).
-
bioRxiv - Cell Biology 2020Quote: ... After 10 min of fixation using 4% neutral buffered formaldeyde (VWR, Darmstadt, Germany), the cell count was assessed by DAPI-staining (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 hours post-transfection cells were fixed in 4% paraformaldehyde (VWR, AAJ61899-AK) for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... the larvae were initially fixed by immersion in 4% paraformaldehyde (VWR:15713-S) /0.1M sodium-cacodylate (VWR:11653) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed with ice cold 4 % paraformaldehyde (PFA)(43368.9M, VWR Stockholm Sweden) and for 15 min and permeabilized with 0.1 % (w/v ...
-
bioRxiv - Immunology 2022Quote: ... Human colon tissue samples were fixed in 4%(w/v) PFA (VWR International) for 24h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed (4% formaldehyde, VWR International, in PBS; 10 min. at RT), washed (2 × 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... jejunum and ileum and fixed overnight (ON) at 4°C in formalin (VWR), a 4% formaldehyde solution buffered to pH 6.9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were briefly fixed in 4% paraformaldehyde (PFA, VWR, Cat # AA-A11313-36) in phosphate buffered saline (PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were washed 4 times with 0.1% NP-40 substitute (VWR, 97064-730) in tris-buffered saline (TBS) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed with 4% formaldehyde stabilized with 0.5-1.5% methanol (VWR, 9713) for 12 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Equal volumes (20 μL) of the cell suspension and 4% trypan blue (VWR) were gently mixed ...
-
bioRxiv - Plant Biology 2024Quote: ... Cultures were grown under constant shaking (VWR shaker model 3500, shaker setting 4), 18°C ...
-
bioRxiv - Neuroscience 2024Quote: ... We fixed the cells with 600 µL of 4% paraformaldehyde solution (VWR International) in PBS for 15 min and washed them with PBS three times ...
-
bioRxiv - Neuroscience 2024Quote: ... and cooling to 4°C using a thermocycler (Avantor VWR, Radnor, PA, USA). All primers were originally designed using NCBI primer blast software ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...