Labshake search
Citations for VWR :
101 - 150 of 868 citations for 6 Aminoindan 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: ... proteins were purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were then transferred overnight in a depigmentation solution of methanol containing 6% H2O2 (VWR, 216763) at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 15 larvae were placed on the surface of a 2% agarose pad in the center of a 10 cm Petri dish equipped with a 12 mm plastic cup at one edge (VWR, #25384-318). Before each experiment ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 6 x 10 minutes with TBS-T and incubated for one minute with a chemiluminesence substrate (Perkin-Elmer: NEL105001EA) and exposed to GE Amersham Hyperfilm ECL (VWR: 95017-661). Membranes were then stripped 2 x 6 minutes with 6 mM Guanidinium Chloride + 5% 2-mercaptoethanol ...
-
bioRxiv - Pathology 2021Quote: Viral RNA was quantitated using single-step RT-quantitative real-time PCR (Quanta qScript One-Step RT-qPCR Kit, QuantaBio, Beverly, MA; VWR; #76047-082) with primers and TaqMan® probes targeting the SARS-CoV-2 E gene as previously described (62) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each plant was sprayed for one minute and the collected flow through from each plant were first strained using a 40 μm cell strainer (VWR 76327-098) to remove large microorganisms and large particles ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were placed in a Leica cryostat one hour prior to sectioning and sectioned at 20 μm onto Superfrost plus microslides (VWR, 48311-703). Samples were stored in -80 °C until use.
-
bioRxiv - Cancer Biology 2021Quote: Cells were treated for 4 h with 4HC or doxorubicin at IC50-range drug concentrations using cells seeded the prior day at 50,000 (E0771) or 75,000 cells per well (4T1, B16F10) of a 6-well plate (cat. #10861-696, VWR). Cells were then washed once with PBS and incubated in fresh media for a total of 24 ...
-
bioRxiv - Developmental Biology 2021Quote: ... HH34 lower jaws were dissected and cultured in 6 well transwell inserts (10769-192, VWR, Radnor, PA, USA) in DMEM complete media ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were again washed in PBS for 6 × 5 mins before mounting onto polylysine-coated slides (Polysine, VWR). Mounted slices were left to dehydrate overnight before applying coverslips using either Aqua-Poly/Mount (Polysciences Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... in HL5 medium containing geneticin (G418, 20μg/ml) and hygromycin (50μg/ml) in culture treated 6-well plates (VWR) and cultured overnight at 23°C ...
-
bioRxiv - Neuroscience 2024Quote: ... with all SGZ-derived NSCs transferred to Sterile tissue culture treated 6-well plate (VWR, Cat# 10861-696) at 10 DIV following P1 passage ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were grown in 6-well plates after placing round coverslips in the bottom of the wells (VWR), or in PhenoPlates 96-well (Perkin Elmer) ...
-
bioRxiv - Cell Biology 2019Quote: ... Single cells were sorted into 200 μL fresh culture medium in one well of a 96-well flat bottom plate (VWR Catalog #29442-054).
-
bioRxiv - Synthetic Biology 2020Quote: ... 3-D spheroids were generated by seeding 2.0E6 cells per well of a 6-well cell repellent plate (VWR) in a final volume of 4.0 mL complete media and placed on an orbital shaker at 95 RPM for 24 hours ...
-
bioRxiv - Bioengineering 2019Quote: ... undifferentiated hPSCs were initially seeded at 1.0 million cells/1mL in ultra-low attachment 6 well plates (Corning, VWR) placed on a 9-Position stir plate (Chemglass ...
-
bioRxiv - Cancer Biology 2020Quote: ... MSCs were plated at 1.75×105 cells per 4.2cm2 of a 6-well transwell insert (Falcon 353090, VWR, Germany).
-
bioRxiv - Neuroscience 2022Quote: ... the cell strainer was removed from the testing arena and dropped into a 6-well dish (VWR 10861-554) containing 4% PFA in 1x PBT (1x PBS + 0.25% TritonX100) ...
-
bioRxiv - Biochemistry 2022Quote: ... HEK293 Flp-in T-REx/GFP-LRRK1 cells were seeded at 2.5 x 105 cells/well in 6 well plates on glass coverslips (VWR, 631-0125 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Peak fractions were analyzed using SDS-PAGE and were further purified in a Superose 6 Increase 10/300 (VWR) using Buffer A as running buffer (free of EDTA/PMSF) ...
-
bioRxiv - Biophysics 2020Quote: Samples were vacuum dried and re-suspended in 6 µl of Buffer A (0.1% Formic acid (Roth) in MS grade water (VWR)).
-
bioRxiv - Cancer Biology 2023Quote: ... at 37 °C for 25 min while stirring at 900 RPM (speed 4/6) on a hotplate stirrer (VWR). The digested suspension was strained through a 70-um strainer ...
-
bioRxiv - Immunology 2023Quote: ... VRE colonization levels were monitored by plating fresh stool that was serially diluted in PBS on Enterococcus selective Bile Esculin Azide Agar (BEA) media (Remel) Supplementary Fig.ed with vancomycin 6 μg/mL (VWR), erythromycin 4 μg/mL (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... cultured in 150mm dish (Alkali scientific TDN0150) for protein experiment and in 6-well culture plate (VWR, 100062-892) for total RNA experiment and transfected at around 50-60% confluency ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were then washed 5 times in PBS before addition of 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid (ABTS) substrate (VWR), and incubation at 37°C for 15 minutes ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were typically grown in 6-well plates after placing round coverslips in the bottom of the wells (VWR), or in PhenoPlates 96-well (Perkin Elmer) ...
-
bioRxiv - Bioengineering 2021Quote: ... The samples were washed three times with PBST and then incubated with 4′,6-diamidino-2-phenylindole (DAPI, 5 µg/mL in PBS) (VWR) and phalloidin (1.5 µM in DMSO ...
-
bioRxiv - Biochemistry 2021Quote: For transductions VeroE6 or HEK cells were seeded into greiner CELLSTAR® 96-well plates or 6-well plates (VWR) containing lentivirus in DMEM containing 2 % FBS and 1 μg/mL polybrene ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 μL of the culture was inoculated into 3 mL of MSgg liquid media in a 6-well or 12-well microtiter plate (VWR). The plates were incubated at 30°C for 2-3 days ...
-
bioRxiv - Microbiology 2020Quote: ... animals were randomly assigned to individual cages under one of four groups (n=8 per group): Wild-type (WT) C57BL/6 mice with access to a free running wheel (VWR) or a locked wheel (SED) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Jag1-Fc was immobilized by overnight incubation at 4°C in individual wells of non-tissue culture-treated 6 or 12 well plates (VWR) at a final concentration of 2 µg/mL in DPBS containing 10 µg/mL poly-D-lysine (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Biochemistry 2022Quote: ... 50 µL of each was added to 2 mL cultures of attached cells in 6-well plates (#10861-554, VWR) containing 0.2 mM CaCl2 ...
-
bioRxiv - Biochemistry 2022Quote: Each <3 kDa FBS extracted material was added to >30 kDa FBS fraction in 2 mL FBS-free media in the well of a 6-well plate (#10861-554, VWR) at roughly 10X the concentration they would exist in the standard growth media ...
-
bioRxiv - Molecular Biology 2023Quote: Monocytes were isolated as described above and 3×106 cells/ml were plated in a 6-well plate using RPMI-1640 medium (#392-0427, VWR) supplemented with 10% FBS (#11573397 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2021Quote: ... and a dye photosensitizer in N,N-dimethylformamide/acetone (7/3, v/v) was electrospun onto one layer of polypropylene (PP) fabrics (VWR® Basic Protection Face Mask). During the electrospinning of 10-20 wt% of PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were plated in 6-well plates at 1 million cells per well and the following day were transfected with 2 μg DNA using 6 μl of JetPrime (VWR International) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... equal numbers of cells were counted by Moxi Mini automated cell counter (Orflo) and 0.6×10^6 cells per data point were seeded in T-25 cell culture flasks (VWR, PA, USA) in appropriate volume of culture medium ...
-
bioRxiv - Microbiology 2022Quote: ... PS01156 or both PS01155 and PS01156 (∼6*107 CFU/ml) in polypropylene conical tubes (cat. no. 89039-670, VWR, Radnor, PA) in BHI broth ...
-
bioRxiv - Molecular Biology 2023Quote: ... animals of the indicated genotype were washed out of wells on a 6-well plate at the indicated timepoints with M9+0.05% gelatin (VWR, 97062-620), transferred to a 1.5 ml tube and washed twice more with M9+0.05% gelatin ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 mM imidazole and 200 mM NaCl was added before loading on a self-packed 3 ml Ni Sepharose™ 6 Fast Flow (VWR) column using ÄKTA Pure FPLC system (Cytiva ...
-
bioRxiv - Neuroscience 2019Quote: ... Our CAFÉ assay consisted of a 6-well plate with 4 small holes drilled for the insertion of pipette tips and 20 µl capillaries (VWR, Radnor, PA). Capillaries were filled via capillary action ...