Labshake search
Citations for VWR :
401 - 450 of 1354 citations for 6 Chloro 1 2 dihydro 3H indazol 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Jag1-Fc was immobilized by overnight incubation at 4°C in individual wells of non-tissue culture-treated 6 or 12 well plates (VWR) at a final concentration of 2 µg/mL in DPBS containing 10 µg/mL poly-D-lysine (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures for experiments were grown in flat-bottom 3 L polycarbonate Erlenmeyer flasks (VWR, Germany) at 22-25 °C ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 l ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Bioengineering 2020Quote: ... (3) we then pipette the solutions vigorously in a 20 mL scintillation glass vial (VWR) with a hydrophobic coating which is introduced by incubation with Rain-X (ITW Global Brands ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected for five days in presence of 3 μg/ml puromycin (VWR, CAYM13884). A near 100% GFP-positive population was confirmed via microscopy (ZOE Fluorescent Cell Imager ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescence intensity (∼485 nm/∼530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR).
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine (BioWhittaker) and 10% bovine calf serum (VWR). Cos-7 cells (a gift of Dr ...
-
bioRxiv - Systems Biology 2023Quote: ... containing 2% formic acid (FA; ≥99%. VWR International, Vienna, Austria). The eluted samples were dried using a gentle nitrogen stream at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... a coverslip (VWR, No. 2, 181×8 mm, #48366-045) was coated with Poly-D-lysine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 0.5 mg/mL in PBS + 2% sucrose (VWR, #27480.294). Coverslips were placed on a piece of parafilm ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected with 2 μg/ml puromycin (VWR, CAYM13884) for five days and subsequently split into the different screening condition arms ...
-
bioRxiv - Immunology 2023Quote: ... The samples were stored in 2 ml ethanol (VWR, 20821.330P). Clean and fire-sterilized scissors and forceps were used for each intestinal section to minimise bacterial DNA contamination ...
-
bioRxiv - Bioengineering 2023Quote: ... and the photoabsorber 2-isopropylthioxanthone (ITX, no. TCI0678; VWR International) (0.8 w/w) ...
-
bioRxiv - Bioengineering 2024Quote: ... filtered with a 2 μm cellulose filter (VWR, #514-0061) and supplemented with 2 % fluorinated surfactant FluoSurf neat (Emulseo ...
-
bioRxiv - Immunology 2020Quote: ... equal numbers of cells were counted by Moxi Mini automated cell counter (Orflo) and 0.6×10^6 cells per data point were seeded in T-25 cell culture flasks (VWR, PA, USA) in appropriate volume of culture medium ...
-
bioRxiv - Microbiology 2022Quote: ... PS01156 or both PS01155 and PS01156 (∼6*107 CFU/ml) in polypropylene conical tubes (cat. no. 89039-670, VWR, Radnor, PA) in BHI broth ...
-
bioRxiv - Molecular Biology 2023Quote: ... animals of the indicated genotype were washed out of wells on a 6-well plate at the indicated timepoints with M9+0.05% gelatin (VWR, 97062-620), transferred to a 1.5 ml tube and washed twice more with M9+0.05% gelatin ...
-
bioRxiv - Cell Biology 2020Quote: NGM plates with a final concentration of 1μM auxin (indole-3-acetic acid, VWR AAA10556-36) were made according to [60] ...
-
bioRxiv - Genetics 2019Quote: ... Digested products were electrophoresed on 3% agarose gels using Agarose SFR™ (VWR Life Science, USA) for 3 hours at 80V ...
-
bioRxiv - Biochemistry 2021Quote: ... The gel was stained with Ethidium Bromide and visualised using a Smart 3 GelDoc System (VWR).
-
bioRxiv - Cell Biology 2023Quote: ... Plates were spun and then incubated at 91°C for 3 min on heat blocks (VWR), then 60°C for 20 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... The 3’ end enriched libraries were constructed using KAPA HyperPlus Library Preparation Kit (VWR International, KK8513) with 6 cycles of PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were washed in PBS (3 x 5 min) and mounted on slides (Superfrost Plus, VWR) with mounting medium (Fluoromount ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sample-beads were then washed with 3 mL 75-80% ethanol (VWR Chemicals, PA, USA) and again with 2 mL 75-80% ethanol ...
-
bioRxiv - Neuroscience 2019Quote: ... Our CAFÉ assay consisted of a 6-well plate with 4 small holes drilled for the insertion of pipette tips and 20 µl capillaries (VWR, Radnor, PA). Capillaries were filled via capillary action ...
-
bioRxiv - Cancer Biology 2022Quote: Splenocytes were isolated from the spleen of 6-10-week-old OT-I male mice and pulsed with 2ug/ml of OVA peptide SIINFEKL (VWR, H-4866.0001BA) for 4 h in T cell culture media composed of RPMI1640 (GE Healthcare ...
-
bioRxiv - Developmental Biology 2023Quote: ... each organoid was cut into 6 pieces using needles and subjected to shaking culture at 120 rpm (VWR Orbital Shaker Model 1000) in KR5 medium to develop cysts ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected into single wells (3.5 cm) of the Corning Costar 6-well cell culture plate containing HEK293T/17 cells using the JetPrime Transfection reagent (VWR, Randor, PA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 400,000 cells were seeded on ethanol-sterilised coverslip in 6 well 3.5 cm diameter plate containing 22 × 22 mm glass coverslips (VWR. Cat# 631-0125). 2 μg of DNA and 6 μg of PEI were diluted in 0.25 ml of Opti-MEM™ Reduced serum medium (Gibco™) ...
-
bioRxiv - Cell Biology 2023Quote: Lyophilized liver samples were homogenized in 10 mM phosphate buffer at pH 6 (28 mg tissue per ml buffer) on a bead beater (VWR, Radnor, PA) for 1 min ...