Labshake search
Citations for VWR :
401 - 450 of 894 citations for 4 Methoxy 6 methyl 6 phenyl 5H pyran 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... primary neurons were fixed using ice-cold paraformaldehyde (4% in PBS, VWR) for 10 min at 4 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... Brains were embedded in 4% Agarose (#9012366, VWR Life Science, Hannover, Germany) and were cut into 100 ...
-
bioRxiv - Immunology 2022Quote: ... the bound EVs were fixed with 4% paraformaldehyde (Cat. No. 20909.290, VWR) for 20 minutes at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: The scaffolds used for microscopy were fixed with 4% Paraformaldehyde (PFA) (VWR) for 1 hour and subsequently placed in PBS until further processing ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed using a 4% paraformaldehyde solution in HBSS (VWR) for 15 mins at RT ...
-
bioRxiv - Systems Biology 2024Quote: ... The ICC protocol included fixing cells with 4% PFA (VWR, 100496-496), permeabilization with 0.1% Triton X-100 in PBS (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... air-dried and then extracted via gravity flow using 2 mL of methanol followed by 2 mL of methanol/tetrahydrofuran 1:1 (tetrahydrofuran HiPerSolv, VWR, Dresden, Germany). This extract was frozen until further chemical analysis.
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then blocked in 2% BSA in PBS for 30 min and then incubated with primary antibodies in 2% RNAse-Free BSA (VWR, 97061-420) for 2 hrs at 37 °C (see a detailed antibody list in Supplementary Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... Separately sterilized 2% D-(+)-glucose monohydrated (VWR Chemicals, Germany) was added to the medium ...
-
bioRxiv - Bioengineering 2020Quote: ... and coated overnight in 2 mg/mL BSA (VWR) at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to a 2 mL homogenizer (VWR International). To generate synaptosomes ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine and 10% bovine calf serum (VWR) was used during live imaging processes.
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2% Proteinase K (20 mg/ml, VWR) was added per 1 g of tissue ...
-
bioRxiv - Systems Biology 2020Quote: ... supplemented with 2% Fetal Calf Serum (VWR #89510-184). After 16h ...
-
bioRxiv - Immunology 2020Quote: ... Slides were incubated in 2% sodium borohydride (VWR, BDH4604) in PBS for 40 minutes at RT to remove auto fluorescence ...
-
bioRxiv - Neuroscience 2022Quote: ... cleared in a solution of xylene (2 min; VWR, International ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR bands were visualized on 2% agarose (VWR, 97062) in TBE (VWR ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM phenylmethylsulfonyl fluoride (VWR Life Science, Radnor, PA) and the protease inhibitor cocktail ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 2 Glass Coverslips (# 48382-085) were purchased from VWR. RNeasy mini prep kit (# 74106 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed in 2% paraformaldehyde (VWR International, Inc.) to assess pan-immune cells in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL 5x SYBR green (VWR, CN 12001-796), and 1.4 µL nuclease-free water ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5% 2-mercaptoethanol (VWR Life Science #M131-100ml) and then ran on 4-20% Criterion TGX pre-cast gels (Bio-Rad #5671093) ...
-
bioRxiv - Biochemistry 2024Quote: ... Tris(2-carboxyethyl)phosphine hydrochloride (TCEP) (97064-850, VWR), Tris base (T1378-5KG ...
-
bioRxiv - Neuroscience 2024Quote: ... slow frozen using 2-methylbutane vapors (VWR, 103525-278) submerged in liquid nitrogen and stored at -80°C until use ...
-
bioRxiv - Immunology 2024Quote: ... 5% FBS and 2 mM ethylenediaminetetraacetic acid (EDTA, VWR), mashed and filtered through a 70 μm cell strainer ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted in 10 mL DPBS containing 2% BSA (VWR), spun down at 250 g for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transferred to 2 mL cryovials (VWR, Canada). The cryovials were then placed in a CoolCell (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μM PP2 (Avantor/VWR, stock diluted 1:25) was used as a positive control ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Microbiology 2021Quote: ... and a dye photosensitizer in N,N-dimethylformamide/acetone (7/3, v/v) was electrospun onto one layer of polypropylene (PP) fabrics (VWR® Basic Protection Face Mask). During the electrospinning of 10-20 wt% of PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Cell Biology 2020Quote: ... After 10 min of fixation using 4% neutral buffered formaldeyde (VWR, Darmstadt, Germany), the cell count was assessed by DAPI-staining (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 hours post-transfection cells were fixed in 4% paraformaldehyde (VWR, AAJ61899-AK) for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... the larvae were initially fixed by immersion in 4% paraformaldehyde (VWR:15713-S) /0.1M sodium-cacodylate (VWR:11653) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-4 μl were mounted on a SuperFrost microscope slide (VWR; 631-0847), covered with a glass cover slip (VWR ...
-
bioRxiv - Neuroscience 2021Quote: ... 3-4 mid-sagittal sections were mounted on Superfrost Plus microscope slides (VWR) using Vectamount mounting media containing DAPI (Vector Laboratories) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed with ice cold 4 % paraformaldehyde (PFA)(43368.9M, VWR Stockholm Sweden) and for 15 min and permeabilized with 0.1 % (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were washed 4 times with 0.1% NP-40 substitute (VWR, 97064-730) in tris-buffered saline (TBS) ...
-
bioRxiv - Plant Biology 2022Quote: ... 4-day-old seedlings were placed in a 1-well chambered coverglass (VWR, Kammerdeckglä ser ...
-
bioRxiv - Neuroscience 2024Quote: ... We fixed the cells with 600 µL of 4% paraformaldehyde solution (VWR International) in PBS for 15 min and washed them with PBS three times ...
-
bioRxiv - Neuroscience 2024Quote: ... and cooling to 4°C using a thermocycler (Avantor VWR, Radnor, PA, USA). All primers were originally designed using NCBI primer blast software ...
-
bioRxiv - Plant Biology 2024Quote: ... Cultures were grown under constant shaking (VWR shaker model 3500, shaker setting 4), 18°C ...
-
bioRxiv - Microbiology 2023Quote: ... Equal volumes (20 μL) of the cell suspension and 4% trypan blue (VWR) were gently mixed ...
-
bioRxiv - Immunology 2022Quote: ... Human colon tissue samples were fixed in 4%(w/v) PFA (VWR International) for 24h at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... Multiple 1 l cell cultures in 4 l flasks (VWR cat # 32645–044) were incubated 72 h at 27 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed (4% formaldehyde, VWR International, in PBS; 10 min. at RT), washed (2 × 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... jejunum and ileum and fixed overnight (ON) at 4°C in formalin (VWR), a 4% formaldehyde solution buffered to pH 6.9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were briefly fixed in 4% paraformaldehyde (PFA, VWR, Cat # AA-A11313-36) in phosphate buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed with 4% formaldehyde stabilized with 0.5-1.5% methanol (VWR, 9713) for 12 minutes at room temperature ...