Labshake search
Citations for VWR :
351 - 400 of 2118 citations for Copper;5 10 15 20 tetrakis 4 methylphenyl porphyrin 22 24 diide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 20-50 µM H2O2 (VWR), 10 nM bafilomycin A1 (BAF ...
-
bioRxiv - Microbiology 2020Quote: ... and eluted in 15 μl nuclease-free water (436912C, VWR). RNA was denatured again and pyrophosphates were removed from the 5’-end by 10 U RppH (M0356S ...
-
bioRxiv - Biophysics 2020Quote: ... Mixture was spread in a 150×15 petri dish (VWR) and degassed for 30 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... 15% heat-inactivated fetal bovine serum (VWR Seradigm, 97068-091) and 0.5% Penicillin/Streptomycin (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... 15% fetal bovine serum (FBS) (VWR, 97068-085 Lot 323B20), 100 IU/mL Penicillin and 100 μg/ml Streptomycin (Corning ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 15% tetracycline-free fetal bovine serum (VWR 76308-984), 1% NEAA (Gibco #11140050) ...
-
bioRxiv - Immunology 2024Quote: ... Tissues were dehydrated using an ascending methanol series and bleached overnight at 4 °C in a solution containing 5% H2O2 (VWR Chemicals, Radnor, PE, USA) in methanol ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed overnight at 4 °C with 4% formaldehyde (VWR) in PBS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and cells were resuspended in 65μL RNAase A solution consisting of 10 mg/mL RNAase A (VWR Life Science, 9001-99-4) dissolved in 10 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2021Quote: ... the tissues were mounted with Vectashield Antifade Mountant and coverslipped (24×50mm, VWR, International).
-
bioRxiv - Molecular Biology 2021Quote: ... an equal volume of 25:24:1 phenol-chloroform-isoamyl alcohol (VWR, Radnor, PA) was added and the tubes were vortexed for 30 s followed by centrifugation at 10,000g for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... these were injected into the tail vein through a catheter (24 G Neoflon, VWR) 25min prior to carboxylate dye injection ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Growth plates were incubated at 30°C for 24 hours inside an incubator (VWR, Forced Air Incubator ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 × 50 mm (0.16 – 0.19 mm thickness) cover glass slide (Thermo Fisher or VWR). Cells were cushioned with a 3% (w/v ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Cells were then transferred using tips with wide bore in 24-well plates (VWR) and incubated in the dark at 25°C with shaking (20 rpm ...
-
bioRxiv - Bioengineering 2024Quote: ... according to manufacturers instructions and seeded in a 24-well tissue culture plate (VWR) containing 500 µl cell culture media following transfection ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Growth plates were incubated at 30°C for 24 hours inside an incubator (VWR, Forced Air Incubator ...
-
bioRxiv - Neuroscience 2024Quote: ... Coverslipping was done with DPX (Electron Microscopy Services) and 24×60 mm coverglass (VWR).
-
bioRxiv - Neuroscience 2023Quote: ... and stored at −20 °C in an anti-freeze solution (30 % glycerol [Merck Millipore, Germany], 30 % ethylene glycol [VWR International, USA] and 10 % TBS) until further processing ...
-
bioRxiv - Microbiology 2020Quote: ... Samples for peak isolation were separated on a Vydac Semi-preparative C18 column (218TP510, 5 μm, 300 Å, 10 mm × 250 mm, VWR International B.V ...
-
bioRxiv - Plant Biology 2024Quote: ... Cotyledons of 15-day old seedlings were cut and mounted between two coverslips (18 x 18 mm and 22 x 40 mm, VWR International GmbH, Darmstadt, Germany). The light box setup was previously described in detail in Elsässer et al ...
-
bioRxiv - Microbiology 2023Quote: ... United States of America], 20 g/l mycological peptone [Oxoid, United Kingdom], 20 g/l dextrose, and 20 g/l agar [VWR International Llc, Hungary], pH 5.6). Culturing and biofilm formation were performed in RPMI-1640 (with l-glutamine and without bicarbonate ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cell Biology 2021Quote: Paraformaldehyde (PFA, 4%; VWR) fixed platelet subpopulations were centrifuged onto poly-l-lysine coverslips (VWR ...
-
bioRxiv - Cell Biology 2022Quote: ... 4% SDS (VWR #442444H), 160 mM Tris-HCl pH 6.8 ...
-
bioRxiv - Microbiology 2021Quote: ... The entire amount of plasma (about 180 µL) was filtered using 0.2 µm centrifugal tube from VWR (5 min, 10°C, 10000xg). Next ...
-
bioRxiv - Bioengineering 2022Quote: ... centrifuged for 3 minutes at 300 g and resuspended in E8 flex medium containing 10 μM Y27632 ROCK inhibitor (VWR, #688000-5). Cells were counted and plated at a density of 500 cells per well in a 96-well ultra-low attachment U-bottom plate (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... Gryphon cells were cultivated according to manufacturer’s instructions at 5% CO2 37 °C in 10 cm tissue culture-treated dishes (VWR Canada, Mississauga, ON) in DMEM-high glucose (Life Technologies ...
-
Autologous humanized PDX modeling for immuno-oncology recapitulates the human tumor microenvironmentbioRxiv - Cancer Biology 2022Quote: ... BM aspirates were performed using a 15 Gauge Illinois needle (VWR) with standard technique ...
-
bioRxiv - Immunology 2024Quote: ... Lymphoid organs were homogenized in 15 mL dounce tissue grinders (VWR) and CD4+ T cells were enriched via magnetic negative selection (STEMCELL Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: ... The lanes were placed in a 15 cm petri dish (VWR) and filled partially with E3 buffer ...
-
bioRxiv - Immunology 2024Quote: ... samples were sequentially incubated in 15% and 30% sucrose (27,483,294; VWR) in D-PBS solutions at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μL (VWR, catalog # 76322-134).
-
bioRxiv - Biophysics 2022Quote: ... 20% acetic acid (VWR Chemicals, 98%) solution with pH around 1.7 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 20 mM EDTA (VWR E177-500MLDB) 150 mM NaCl (Thermo Fisher Scientific AM9760G) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 20 mg/L MgCl2·6H2O (VWR), 10 mg/L MnCl2·4H2O (Sigma) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 g L−1 peptone (VWR), 20 g L−1 glucose (VWR) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 g L−1 glucose (VWR)) was used for general culturing of yeast cells ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 g L-1 peptone (VWR), 20 g L-1 glucose (VWR) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 g L-1 glucose (VWR)) was used for general culturing of yeast cells ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 g L-1 peptone (VWR), 20 g L-1 glucose (VWR) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 20 g L-1 glucose (VWR)) was used for culturing of yeast strains without the SCRaMbLE reporter ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were seeded at a density of 4x105 cells in 24 mm glass coverslips (VWR) coated with poly-L-lysine ...
-
bioRxiv - Biophysics 2021Quote: ... Two no.1 cover slides (24 × 60 mm and 18×18mm, VWR, Radnor, Pennsylvania, USA) are cleaned by sonication in isopropanol and dried under a stream of N22 ...
-
bioRxiv - Cell Biology 2021Quote: ... a 24-well insert with an 8-μm-pore membrane Trans-wells (VWR International Ltd) was coated with 50 μl of CellMatrix/PureCol collagen mixture (1:1 ...
-
bioRxiv - Plant Biology 2020Quote: All germination assays were performed in sterile 24-well culture plates (VWR International; 734-2779), using 500 μL of the specified solution and dry seeds (typically 20 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T were plated on poly-D-lysine coated 24-well plates (Corning BioCoat, VWR, UK) and transfected with 0.33 μg of EGFP-SNAP25 plasmid and 0.66 μg of pEF-BOS HA plasmid (either empty as a control or encoding the zDHHC enzymes) ...
-
bioRxiv - Developmental Biology 2020Quote: ... cultured for 24 hours in 6-well transwell inserts (10769-192, VWR, Radnor, PA, USA) in complete media ...
-
bioRxiv - Cell Biology 2021Quote: ... thin layer cover glass sandwiches were constructed from passivated 24×60 mm Menzel coverglass (VWR). To clean coverslips ...
-
bioRxiv - Molecular Biology 2024Quote: ... U2OS and HeLa cells were seeded in 24-well plate on #1.5 glass coverslips (VWR), irradiated and/or treated 24 h later ...