Labshake search
Citations for VWR :
301 - 350 of 366 citations for Tripartite Motif Containing 22 TRIM22 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Rpoβ (anti-RNA polymerase beta mouse monoclonal antibody [clone: 8RB13]; VWR) was diluted 1:20,000 ...
-
bioRxiv - Neuroscience 2020Quote: ... A maximum of 7.5% of the body weight was obtained in BD vacutainer tubes containing EDTA as anticoagulant (VWR, Ville Mont-Royal, Quebec). Adolescent mice were closely monitored for bleeding ...
-
bioRxiv - Microbiology 2022Quote: ... Supplemented M9 containing 0.85 mg/mL pluronic F127 without antibiotics was flowed via Tygon Microbore silicon tubing (VWR ND 100-80/0,508*1,524) that linked the device to a syringe pump (ALADDIN-220 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... each of which was part of a larger chamber containing 12 arenas each with a diameter of 2.54 cm (VWR cat. no. 89093-496). The bottom of each chamber contained a standard amount of either grapefruit medium or medium in which 15% of the water has been replaced with ethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5% (w/v) non-fat dry milk in TRIS-buffered saline (TBS) containing 0.1% Tween-20 (TBS-T; VWR, Radnor, PA, USA, # 28829.183) for one hour at room temperature and incubated with primary antibodies overnight at 4°C ...
-
bioRxiv - Genetics 2019Quote: We performed cell culture using the conditions described above in 12-well plates containing sterile 18-mm glass cover slips (VWR, Cat#48380-046). We fixed cells for 10 minutes in 4% paraformaldehyde (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Antibiotic tolerance assays using co-cultures were performed using a membrane-separated 12-well tissue plate cultures containing 0.1 μm pore PET membranes (VWR, Cat. No. 10769–226), following previously protocols (Meirelles et al. ...
-
bioRxiv - Immunology 2023Quote: ... The wells were emptied and blocked with 300 µL of PBS containing 1% BSA (Bovine Serum Albumin Fraction V, VWR Cat# 97061-416) for 1 h at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... we seeded 2×104 ESCs per well of a Geltrex-coated 12-well plate for subsequent RT-PCR and RT-qPCR analyses and 1-3×103 cells per well of a 12-well plate containing a Geltrex-coated 18-mm glass coverslip (VWR, cat# 631-1580) for immunostaining ...
-
bioRxiv - Genetics 2023Quote: ... with a scalpel on a cold block (Figure 1b) and resuspended on ice in 1 ml of lysis buffer containing 0.32 M Sucrose (VWR Catalog No. 97061-432), 10 mM Tris-HCl pH 8 (Invitrogen REF 15568-025) ...
-
bioRxiv - Cell Biology 2023Quote: ... and IRDye 680RD Goat-anti-Mouse antibody (VWR, Cat No:102673-408) at 1:20,000 dilutions ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... co-culture experiments were performed using membrane-separated 12-well tissue plate cultures containing 0.1 µm pore PET membranes (VWR® Cat. No. 10769-226). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Physiology 2024Quote: ... Western blot secondary antibodies included: donkey anti-rabbit HRP (VWR 95017, 1:1000) and sheep anti-mouse (GE Healthcare #NA931V ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... infrared (IR)-dye conjugate secondary antibodies IRDye 800CW Donkey Anti-Goat (VWR, #102673-336), IRDye 800CW Donkey Anti-Rabbit (VWR ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-rabbit secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-mouse secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-rabbit secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Cell Biology 2019Quote: ... A goat α-mouse secondary antibody conjugated to a 680 nm emitting fluorophore (VWR/Biotium ...
-
bioRxiv - Developmental Biology 2020Quote: ... for blocking and with 0,2% Tween® 20 added for antibody dilutions (28829.296, VWR), washes were done with phosphate-buffered saline tween (PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Blocking buffer and primary antibody incubation solution was 5% non-fat dairy milk powder (VWR) or 5% (w/v ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were detected by immunoblotting using the following primary antibody concentrations in 5% milk (VWR)/Tris Buffered Saline -Tween20 (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... and secondary antibodies were diluted to 1:10,000 (100 ng/mL) in 2.5% BSA (0332, VWR) in Tris buffered saline tween ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were incubated in a primary antibody (CD63 for the endosomal system, clone MX-49.129.5, VWR, anti-LAMP1 for lysosomes ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were probed with mouse anti-α-tubulin antibody (DM1A, VWR; #PI62204; 1:1000 in blocking buffer) for 1h at room temperature ...
-
bioRxiv - Biochemistry 2019Quote: ... The labelled antibodies were dissociated from the beads by adding 15 μl 0.2M acetate (97064-482, VWR), pH 3.2 (elution buffer ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μL of HRP-labelled Rabbit Anti-Sheep IgG (H+L) secondary antibody (VWR, Batavia, IL, USA) diluted 1:1000 (100ng/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated for 48 hr at 4°C with an antibody against RFP (1:1000, Rockland (VWR), catalog #RL600-401-379) ...
-
bioRxiv - Genomics 2019Quote: ... Western blots were performed using a mixture of mouse anti-actin antibodies (VWR catalog number 89500-294) and rabbit anti-TAP antibodies (ThermoFisher catalog number CAB1001 ...
-
bioRxiv - Systems Biology 2023Quote: ... during the secondary antibody staining and plates were sealed with adhesive foil (VWR Cat. No. 60941-124). Cells/nuclei were imaged on either an Opera Phenix high-content screening system (PerkinElmer ...
-
bioRxiv - Immunology 2021Quote: Human IgM antibodies were detected in sera from passively transferred mice using high-binding 384-well plates (VWR) coated with 0.5 µg/well of goat anti-human Ig polyvalent antibody (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkaline phosphatase coupled secondary antibodies were used for all blots followed by direct detection with NBT/BCIP (VWR) substrates on PVDF membranes.
-
bioRxiv - Physiology 2020Quote: ... with bound antibodies eluted using glycine elution buffer [6.3 ml of 100 mM glycine (VWR Chemicals, Leicestershire, UK) and 0.7 ml of Tris (1M ...
-
bioRxiv - Microbiology 2022Quote: ... Biofilms were incubated with anti-Candida antibodies diluted into dilution buffer (PBS with 0.05% Tween (VWR M147-1L), 0.1% BSA ...
-
bioRxiv - Bioengineering 2023Quote: ... primary antibodies were added to the blocking solution for 20 minutes while rocking (VWR analog rocker 10127-876), in the dark and on ice ...
-
bioRxiv - Genetics 2019Quote: ... Eluates were analysed by SDS-PAGE followed by western blotting with antibodies anti-V5 tag (VWR, MEDMMM-0168-P), anti-Pgk1 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μL of HRP-labelled Rabbit Anti-Deer IgG (H+L) secondary antibody (95058-328, VWR, Batavia, IL, USA) diluted 1:1000 (100ng/mL ...
-
bioRxiv - Genomics 2020Quote: Library preparation for each CUT&RUN antibody condition was done with a KAPA Hyper Prep Kit (VWR, 89125-040) with the PCR amplification settings adjusted to have simultaneous annealing and extension steps at 60 °C for 10 seconds ...
-
bioRxiv - Cancer Biology 2019Quote: ... Lysates were probed with antibodies diluted in 5% non-fat dry milk in Tris buffered saline (VWR #J640-4L) and 0.1% Tween20 (Fisher Scientific #BP337 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The primary and the secondary antibodies were prepared in the blocking agent consisting of 0.1% Triton X-100 and 3% goat serum (VWR). Followed by washing the organoids with PBS 3x5min on a rocker ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were washed in PBST and followed by incubation with HRP-conjugated secondary antibody (goat antirabbit, VWR/Jackson Immunoresearch). Then avidin–biotin peroxidase complex (Vectastain ABC kit ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated for 1-2 hours at RT with primary antibodies diluted in Odyssey Blocking Buffer + 0.2% Tween (VWR). Next ...
-
bioRxiv - Cell Biology 2019Quote: ... The donkey anti-rabbit (NA934, 1:1000) and anti-mouse (NA931, 1:1000) horseradish peroxidase (HRP)-linked secondary antibodies were purchased from VWR. The GFER rabbit polyclonal antibody (#HPA041227 ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies were produced by co-transfecting paired heavy- and light-chain antibody-expressing plasmids at a ratio of 1:1 using FectoPRO DNA Transfection Reagent (VWR) into Expi293 cells ...
-
Regulation of skeletal muscle metabolism and contraction performance via teneurin-latrophilin actionbioRxiv - Physiology 2021Quote: ... The membranes were washed 3x in PBST at RT and incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (VWR, Amersham ...
-
bioRxiv - Neuroscience 2021Quote: ... primary antibodies (1:1000 goat anti-GFP from Novus Biologicals or 1:10 000 rabbit anti-RFP from VWR (Rockland) were incubated with PGT overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Afterward membranes were washed 3X with TBST and incubated with HRP-conjugated secondary antibodies for 1h and then were washed again and revealed by ECL (VWR) chemiluminescence.
-
bioRxiv - Genetics 2022Quote: ... A nonspecific antibody binding was prevented by an incubation of the fixed embryos in 3% BSA (VWR Life Science, 422351S) in PBS-T (1h ...