Labshake search
Citations for VWR :
301 - 350 of 1194 citations for 7 8 Dihydro 6H 1 6naphthyridin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/ streptomycin (Wisent).
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Immunology 2022Quote: Splenic T-lymphocytes were counted and plated at an optimal seeding density of 8×104 cells per 100 µL in 96 well Microtitration ImageLock plates (VWR, #4379, Radnor, PA, USA). The cells were cultured with anti-CD3 and anti-CD28 activation beads and imaged over the course of 96hrs in the Essen Bioscience IncuCyte S3 Live-Cell imager and analysis system.
-
bioRxiv - Biophysics 2024Quote: ... 293T/17 cells were plated in complete DMEM at 8 × 105 cells per well in a 6-well plate with an autoclaved glass coverslip (VWR, no. CLS-1760-025) to ensure 80% confluency on the day of the experiment ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 104 of RPE1 cells were plated on PLL coated coverslips (VWR) one day before quiescence induction and 3 × 104 cells were plated for proliferating condition.
-
bioRxiv - Biochemistry 2022Quote: ... The membrane was blocked with 5% bovine serum albumin (VWR, Batavia, IL) in PBS containing 0.1% Tween-20 for one hour at room temperature and then incubated in primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2021Quote: ... Sections were blocked with 5% donkey serum in 0.3% Tween20 (VWR, 437082Q) in PBS (PBST ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were developed for 5 minutes with TMB substrate (VWR 95059-286), with development stopped with an equal volume of 2 N sulfuric acid and plates read at 450 nm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Remaining biofilm was removed and homogenized with glass beads (5 mm, VWR International AG ...
-
bioRxiv - Genetics 2020Quote: ... 5 μL of 1.25 mg/mL zymolyase-100T (VWR IC320932; Radnor, PA) was used during the spheroplasting ...
-
bioRxiv - Bioengineering 2022Quote: ... cell culture media supplemented with 5% heat-inactivated fetal bovine serum (VWR) and penicillin/streptomycin (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... blocked for 1hr at RT with 5% normal donkey serum (NDS, VWR) in PBS with 0.25% Triton-X (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... animals were soaked in 20 mg/mL 5-bromo-2’-deoxyuridine (VWR) with 3% DMSO in a 6 g/L Instant Ocean salt solution for 2 hours followed by a 4-hour chase prior to processing using the rapid protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... or non-treated 6 well plates (VWR 10861-554. 5 ml/well) and incubated for four days in a 37°C oven ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5-min immersion in Form Wash using isopropanol (Cat. #: 20922.320, VWR) was used as the solvent to remove the unpolymerized resin from the surface of the printed parts ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBS and blocked with 5% IgG-free BSA (VWR, 102643-516) in PBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... After 5 washes of 30 min with PBS-triton 0.8% (28817295, VWR), larvae were incubated with the secondary antibody using 1% goat serum (16210064 ...
-
bioRxiv - Biophysics 2021Quote: ... a dauer suspension of 5 μl was pipetted onto a coverslip (VWR International) and exposed to 98% RH (relative humidity ...
-
bioRxiv - Cancer Biology 2019Quote: ... in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 5% FBS (VWR Life Science Seradigm ...
-
bioRxiv - Neuroscience 2020Quote: ... Adeno-associated viruses (AAVs) were infused with calibrated 5 µl glass pipettes (VWR) pulled to have a tip diameter of 3 µm ...
-
bioRxiv - Genomics 2019Quote: ... and 5 min at 70 °C on a UnoCycler 1200 (VWR, Radnor, USA). Quantitative PCR was conducted on a Rotorgene Q (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Adeno-associated viruses (AAVs) were infused with calibrated 5 µl glass pipettes (VWR) pulled to have a tip diameter of 3 µm ...
-
bioRxiv - Microbiology 2021Quote: ... The grid was stained 3x with 5 μL of 2% uranyl acetate (VWR) with blotting immediately after application for the first two rounds of staining ...
-
bioRxiv - Biochemistry 2022Quote: ... and adding 5-10% inactivated foetal bovine serum (FBS; VWR Canada #97068-085).
-
bioRxiv - Biochemistry 2021Quote: ... and adding 5-10% inactivated foetal bovine serum (FBS; VWR Canada #97068-085).
-
bioRxiv - Microbiology 2022Quote: ... then disrupted 5 times with a dounce homogenizer (VWR cat. no. 62400-595). Following mechanical disruption ...
-
bioRxiv - Microbiology 2023Quote: ... plated for CFU on 5% sheep blood in tryptic soy agar (VWR International) and divided between two 1.5 mL microcentrifuge tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 5 mL of 30% Percoll (VWR; cat# 89428-524) and then overlaid on top of 5 mL 70% Percoll at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... with every section collected serially on 5 Superfrost Plus slides (VWR, Lutterworth, UK) and each slide containing 1 in every 5 sections (4-7 sections per slide) ...
-
bioRxiv - Genomics 2024Quote: ... 5 mM Na3 citrate 2H2O) with ∼75u/mL Pronase E (VWR, Radnor, PA) was added to each sample ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 Prime heavy 2 mL-phase lock gels (#2302830) were from VWR (Radnor, PA). High Capacity cDNA Reverse Transcription Kit (#4368814 ...
-
bioRxiv - Microbiology 2019Quote: ... and mutant strains used 5 ml M9-Goodies with 1.0 mM phenol (≥99%, VWR International ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mobile phases were: A as 5 mM NH4OAc (≥99%, HiPerSolv CHROMANORM®, VWR) aqueous buffer ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 5 % heat-inactivated fetal bovine essence (FBE) (VWR10803-034, VWR Life Sciences), 1 % Penicillin/Streptomycin (P/S ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA was extracted using a bead homogenizer (30 seconds, setting ‘5’’; Bead Mill, VWR) in Trizol reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2019Quote: ... and drops of 5 µl were deposited on a regular microscope glass slide (VWR) coated with 1% agarose-in-MM ...
-
bioRxiv - Developmental Biology 2020Quote: ... Membrane was washed in TBST and blocked in TBST + 5% milk (VWR # 10128-600) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... The fusion product was dissolved in 50 ml of 5 molar HNO3 (Normapur, VWR, Germany ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 min) with 0.5 mL ice-cold quenching solution (10 mM sodium ascorbate (VWR International ...
-
bioRxiv - Physiology 2021Quote: ... fixed platelets were centrifuged onto poly-L-lysine coverslips (VWR; 600 g, 5 min). Samples were mounted with Prolong Diamond antifade mount (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... — were incubated overnight at 30°C in 5 mL of Marine Broth 2216 (VWR) in a shaking incubator at 220 rpm ...
-
bioRxiv - Cell Biology 2022Quote: 5×104 endothelial cells were seeded to 0.2% gelatin-coated 13mm diameter coverslips (VWR) or 1×104 cells seeded to gelatin-coated 96 well ViewPlates (Perkin Elmer ...
-
bioRxiv - Neuroscience 2022Quote: ... containing three different concentrations of EtOH (5%, 10%, 20%, prepared using 96% EtOH; VWR international #83804.360 diluted to the correct concentration ...
-
bioRxiv - Neuroscience 2022Quote: ... After blocking with 5% bovine serum albumin (BSA; VWR Life Science, Radnor, PA, USA) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... The peritoneum was sutured closed using a 5-0 silk suture (VWR, MV-682) and the skin was then closed using an AutoClip Kit with 9 mm clips (Fine Science Tools ...
-
bioRxiv - Neuroscience 2023Quote: ... before being transferred to 5 ml 30% (w/v) sucrose (VWR Chemicals, Lutterworth, UK) in 1×PBS at 4°C for ∼72 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... ribosome was purified using hydrophobic chromatography (3×5 mL HiTrap Butyl HP column (VWR)) with Fast Performance Liquid Chromatography (FPLC ...
-
bioRxiv - Microbiology 2023Quote: ... Vero E6 (ATCC CRL- 1586) was cultured in DMEM supplemented with 5 % FCS (VWR) and 1 % penicillin−streptomycin−glutamine (PSG ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were detached for passaging by 5 min incubation with trypsin-EDTA (0.25%, VWR). MDA-MB-231 cells were used in studies between passages 45 and 50 ...