Labshake search
Citations for VWR :
301 - 350 of 1315 citations for 1 Benzyl 3 Tert Butyldimethylsilyl Oxy Methyl Piperidin 4 One since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... samples were fixed for 30 min in 4 % formaldehyde (16 % VWR 100503) diluted in pH 7.0 PBS ...
-
bioRxiv - Immunology 2020Quote: ... cells were fixed overnight using 4% formaldehyde made in PBS (VWR, Sweden). The broad extended panel of antibodies used for staining are listed in Supplementary Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... were first fixed in a 4% paraformaldehyde solution (PFA, VWR, #100503 917). They were then prepped for staining by blocking in 1× PBS ...
-
bioRxiv - Immunology 2022Quote: ... murine colon rolls were fixed in 4%(w/v) PFA (VWR International), equilibrated in 30%(w/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fixations were performed at room temperature with 4% paraformaldehyde (CA11021-168, VWR) in PBS for 20 minutes on a rotating platform followed by washing in PBS twice before staining ...
-
bioRxiv - Molecular Biology 2024Quote: ... The tumour pieces used for IF were fixed in 4% formol (VWR) for 45 min at RT and were then placed in cryovials at -25°C for 45 min to freeze ...
-
bioRxiv - Neuroscience 2024Quote: ... primary neurons were fixed using ice-cold paraformaldehyde (4% in PBS, VWR) for 10 min at 4 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... Brains were embedded in 4% Agarose (#9012366, VWR Life Science, Hannover, Germany) and were cut into 100 ...
-
bioRxiv - Immunology 2022Quote: ... the bound EVs were fixed with 4% paraformaldehyde (Cat. No. 20909.290, VWR) for 20 minutes at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: The scaffolds used for microscopy were fixed with 4% Paraformaldehyde (PFA) (VWR) for 1 hour and subsequently placed in PBS until further processing ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then fixed using a 4% paraformaldehyde solution in HBSS (VWR) for 15 mins at RT ...
-
bioRxiv - Systems Biology 2024Quote: ... The ICC protocol included fixing cells with 4% PFA (VWR, 100496-496), permeabilization with 0.1% Triton X-100 in PBS (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures for experiments were grown in flat-bottom 3 L polycarbonate Erlenmeyer flasks (VWR, Germany) at 22-25 °C ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 l ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Bioengineering 2020Quote: ... (3) we then pipette the solutions vigorously in a 20 mL scintillation glass vial (VWR) with a hydrophobic coating which is introduced by incubation with Rain-X (ITW Global Brands ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected for five days in presence of 3 μg/ml puromycin (VWR, CAYM13884). A near 100% GFP-positive population was confirmed via microscopy (ZOE Fluorescent Cell Imager ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescence intensity (∼485 nm/∼530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR).
-
bioRxiv - Cell Biology 2024Quote: Holes were punched using a Harris uni-core 3 mm biopsy puncher (VWR, 89022-356), followed by air drying with a nitrogen gun ...
-
bioRxiv - Immunology 2024Quote: ... the peritoneal cavity was washed out using 3 mL of 0.9 % NaCl solution (VWR, 5929.1000) containing 1 mg/mL EDTA (VWR ...
-
bioRxiv - Neuroscience 2024Quote: ... then the adjacent 3 sections of 10 micron tissue were collected on microscope slides (VWR SuperFrost Microscope Slides ...
-
bioRxiv - Bioengineering 2024Quote: ... dendriplex solutions were vortexed for 10 seconds at medium speed (velocity 3, VV3 vortex, VWR) followed by an incubation of 30 minutes at room temperature (RT) ...
-
GRASP55 Safeguards Proper Lysosome Function by Controlling Sorting of Lysosomal Enzymes at the GolgibioRxiv - Cell Biology 2024Quote: ... Cleared culture supernatants were concentrated using 3 kDa cut-off concentrator tubes (#516-0227P, VWR) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Cell Biology 2020Quote: ... After 10 min of fixation using 4% neutral buffered formaldeyde (VWR, Darmstadt, Germany), the cell count was assessed by DAPI-staining (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 hours post-transfection cells were fixed in 4% paraformaldehyde (VWR, AAJ61899-AK) for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... the larvae were initially fixed by immersion in 4% paraformaldehyde (VWR:15713-S) /0.1M sodium-cacodylate (VWR:11653) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed with ice cold 4 % paraformaldehyde (PFA)(43368.9M, VWR Stockholm Sweden) and for 15 min and permeabilized with 0.1 % (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were washed 4 times with 0.1% NP-40 substitute (VWR, 97064-730) in tris-buffered saline (TBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... We fixed the cells with 600 µL of 4% paraformaldehyde solution (VWR International) in PBS for 15 min and washed them with PBS three times ...
-
bioRxiv - Neuroscience 2024Quote: ... and cooling to 4°C using a thermocycler (Avantor VWR, Radnor, PA, USA). All primers were originally designed using NCBI primer blast software ...
-
bioRxiv - Plant Biology 2024Quote: ... Cultures were grown under constant shaking (VWR shaker model 3500, shaker setting 4), 18°C ...
-
bioRxiv - Microbiology 2023Quote: ... Equal volumes (20 μL) of the cell suspension and 4% trypan blue (VWR) were gently mixed ...
-
bioRxiv - Immunology 2022Quote: ... Human colon tissue samples were fixed in 4%(w/v) PFA (VWR International) for 24h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed (4% formaldehyde, VWR International, in PBS; 10 min. at RT), washed (2 × 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... jejunum and ileum and fixed overnight (ON) at 4°C in formalin (VWR), a 4% formaldehyde solution buffered to pH 6.9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were briefly fixed in 4% paraformaldehyde (PFA, VWR, Cat # AA-A11313-36) in phosphate buffered saline (PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed with 4% formaldehyde stabilized with 0.5-1.5% methanol (VWR, 9713) for 12 minutes at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... and incubated overnight at 4 °C in OCT (Optimal Cutting Temperature) compound (VWR) before storage at −20 °C for cryosectioning and fluorescent in-situ hybridisation (FISH) ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 μL drop of each sample was pipetted onto a glass slide (VWR) and covered with #1 12 mm diameter cover slip (Premium Line) ...
-
bioRxiv - Neuroscience 2024Quote: Whole organoids or human brain tissues were fixed in 4% paraformaldehyde (PFA) (VWR) for 1-2 hours at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... washed three times with PBS and fixed using 4% buffered formaldehyde (VWR, 9713.1000) for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: Vital organs and tumors were fixed in 4% PFA (PFA, clinipath, VWR, Belgium). First ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, catalog # 97062-376, VWR) (5 mg/ml ...
-
bioRxiv - Cell Biology 2020Quote: NGM plates with a final concentration of 1μM auxin (indole-3-acetic acid, VWR AAA10556-36) were made according to [60] ...