Labshake search
Citations for VWR :
251 - 272 of 272 citations for Hexadecanoic acid reaction products with tetraethylenepentamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Both filtered and unfiltered water samples were vortexed and diluted 1:5.75 into 2% (vol/wt) trace-grade nitric acid (VWR, Radnor, PA) in acid-washed polypropylene tubes and stored overnight at ambient temperature ...
-
bioRxiv - Biochemistry 2022Quote: ... HPLC grade Acetonitrile was purchased from P212121 (Ann Arbor, MI) and HPLC grade trifluoroacetic acid was purchased from VWR (Radnor, PA). The water used in all purifications and experiments was obtained from a MilliQ system and had a minimum resistivity of 18 MΩ ...
-
bioRxiv - Genetics 2020Quote: ... the cells were resuspended in 1 ml of sterile water and spread on a plate containing minimal media lacking the corresponding amino acid or nucleotide (YNB or Synthetic Complete (SC): 6.7 g/l yeast nitrogen base (VWR 97064-162), 20 g/l glucose ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were covered with Eagle’s Minimum Essential Medium (without phenol red, supplemented with 5% FBE, non-essential amino acids, 1mM sodium pyruvate (VWR, 45000-710), 2mM L-glutamine ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were diluted with ultrapure water to a final concentration of 0.475 N nitric acid and transferred to metal-free centrifuge vials (VWR, 89049-172) for subsequent ICP-MS analyses.
-
bioRxiv - Evolutionary Biology 2022Quote: ... we thawed yeast RBD library and the Wuhan Hu-1 and Omicron BA.1 strains by inoculating the corresponding glycerol stocks in SDCAA (6.7 g/L YNB without amino acid [VWR #90004-150], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418], 2% dextrose [VWR #90000– 904] ...
-
bioRxiv - Immunology 2022Quote: ... region of the 16S rRNA gene was performed in 20 uL duplicate reactions: 8 uL of 2.5X 5Prime Hotstart Mastermix (VWR, Radnor, PA, USA), 1 uL of 20X Evagreen (VWR) ...
-
bioRxiv - Immunology 2020Quote: ... for 1h30 at 37°C and the reaction revealed with of 3,3’-5,5’-tetramethylbenzidine peroxidase substrate (100 µL/well - KPL, VWR, Fontenay-sous-Bois, France). Absorbencies were read at 450 nm.
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of each reaction were mixed with loading dye and analyzed on a 1% (w/v) agarose gel containing GelRed (VWR, Darmstadt, Germany). The remaining PCR mix was purified using a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RNA/DNA hybrid was tagmented in TD reaction buffer (10 mM Tris-Cl pH 7.6, 5 mM MgCl2, 10% DMF) supplemented with 3.4% PEG8000 (VWR Life Science, Cat.No.97061), 1 mM ATP (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... an adapter PCR reaction was performed as follows: All 8 tubes of a 50 µL PCR strip tube (VWR, catalog # 490003-606) were filled with 2500 ng DNA template ...
-
Synaptonemal Complex dimerization regulates chromosome alignment and crossover patterning in meiosisbioRxiv - Cell Biology 2020Quote: ... pSUN-1::TIR-1::mRuby him-8(tm611) spo-11-aid IV (ROG212) adult hermaphrodites were grown on 1 mM auxin (indole-3-acetic acid, VWR AAA10556-36) and therefore lacked SPO-11 ...
-
bioRxiv - Genetics 2020Quote: ... Transformants were pooled and cultured in low-pH Sabouraud Dextrose Casamino Acid media (SDCAA, per liter - 20 g dextrose, 6.7 grams yeast nitrogen base (VWR Scientific, Radnor, PA), 5 g Casamino Acids (VWR) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Transformants were plated on SDCAA-agar (1.71 g/L YNB without amino acids and ammonium sulfate [Sigma-Aldrich #Y1251], 5 g/L ammonium sulfate [Sigma-Aldrich #A4418], 2% dextrose [VWR #90000–904] ...
-
bioRxiv - Biochemistry 2022Quote: ... Individual yeast colonies were picked into 4mL of pH 4.5 Sabouraud Dextrose Casamino Acid media (SDCAA: Components per liter - 20 g dextrose, 6.7 grams yeast nitrogen base (VWR Scientific, Radnor, PA), 5 g Casamino Acids (VWR) ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatant was passed through a 0.22 µm filter before 0.5 ml was combined with 2 ml of Patton-Reeders solution (0.105 mM calconcarboxylic acid, VWR, in 0.73 M NaOH) and vortexed briefly to mix ...
-
Droplet microfluidic screening to engineer angiotensin-converting enzyme 2 (ACE2) catalytic activitybioRxiv - Bioengineering 2024Quote: ... The sorted yeast cells were collected in a microcentrifuge tube and regrown in pH 4.5 Sabouraud Dextrose Casamino Acid media (SDCAA: Components per liter - 20 g dextrose, 6.7 grams yeast nitrogen base (VWR Scientific, Radnor, PA), 5 g Casamino Acids (VWR) ...
-
bioRxiv - Biophysics 2020Quote: A perfusion chamber was prepared by sandwiching a cover glass (BDH, 22 × 32 mm #1) on top of acid and plasma cleaned cover glass (VWR 24 × 50mm #1.5) containing two lines of Corning High Vacuum Grease ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... At least 100 embryos stored in methanol: acetic acid glacial were dropped onto an uncoated and clean microscope slide (VWR™, 631-1550) and let dry on a wet paper for 30 min ...
-
bioRxiv - Immunology 2024Quote: ... at a concentration of 1x105 neurons/ml so that 1x105 neurons were seeded onto poly-D-lysine (10 µg/mL) coated acid-etched coverslips (VWR,, cat#MSPP-P06G1520F) and cultured at 37°C plus 5% CO2 ...
-
bioRxiv - Microbiology 2021Quote: ... was used to stain nucleic acids following washing away unbound secondary antibodies and samples were covered with VectaShield anti-fade reagent (Vector Laboratories, VWR, Cat# 101098-048) and a coverslip ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...