Labshake search
Citations for VWR :
1151 - 1183 of 1183 citations for 10 Undecenamide N N bis 2 hydroxyethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Transfected cells from 2 wells (technical duplicates) were seeded into 250 mL cell culture flasks with vented caps (10062-860, VWR International, Brisbane, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... puncturing the central mineralized region at different locations with a disposable antistatic microspatula with a diameter of 2 mm (VWR international, Radnor, USA, PA). The samples were then sandwiched between two discs of 3 mm diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... Brains were extracted and fixed for a minimum of 24 hours in PFA at 4 °C and transferred to a 2 % dimethyl sulfoxide solution (VWR International, Radnor, PA, USA) prepared in PB for at least 24 hours at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: Plasmids and corresponding oligonucleotides used in this study are summarized in Supplementary Tables 1 and 2. For DNA preparations, the appropriate enzymes (Fermentas, St. Leon-Rot, Germany) and kits (VWR International GmbH, Darmstadt, Germany) were used ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The active fractions from the NC-MT assay were separated in a 10% SDS gel and stained with coomassie blue (InstantBlue, VWR Chemicals, Darmstadt, Germany) or silver stain kit for mass spectrometry (Pierce/Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 24 h starved polyps were incubated in 1 mM linalool for 10 min in a 60 mm tissue culture dish (VWR International, Radnor, PA). Each animal was pinched using a pair of Dumont No ...
-
bioRxiv - Plant Biology 2021Quote: ... Membrane protein samples containing 1 μg total Chl were solubilized and separated by electrophoresis on a 10 % SDS-polyacrylamide gel using Next Gel solutions and buffers (VWR, Radnor, PA, USA). Proteins were transferred to Immobilon-P PVDF membranes (MilliporeSigma ...
-
bioRxiv - Neuroscience 2021Quote: ... Seed protofibrils were then prepared by sonicating the above incubated fibrils for 10 minutes using a 550T Ultrasonic Cleaner (VWR International, Radnor, PA). Note that the mature fibrils prepared by 23-day incubation were not processed ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were then incubated with 250 nM TG or 10 µM monensin in fresh medium for 0.5 h at 37°C before 40 µM D-biotin (VWR Life Science, Radnor, PA) was added ...
-
bioRxiv - Cell Biology 2020Quote: ... The cultivation media used for each cell line was recommended by the supplier with an addition of 10% Fetal Bovine Serum (FBS, VWR, Radnor, PA, USA). For immunostaining ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% (HeLa) or 15% (Tig-1) fetal bovine serum (HyClone, GE Healthcare Life Sciences, Marlborough, MA; Avantor Seradigm, VWR, Radnor, PA), 100 units/mL penicillin and 100 µg/mL streptomycin (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... We prepared a 1:10 dilution with approximately 1 g of fecal sample that was measured with a sterile plastic spoon (VWR International, Dietikon, Switzerland) and subsequently suspended in 9 mL of anaerobic dilution solution ...
-
bioRxiv - Neuroscience 2023Quote: Monolayer cultures grown on Geltrex™ or laminin-coated #1.5 glass coverslips were fixed in 10% buffered formalin (Cat# CA71007-344, VWR, Radnor, PA, USA) for 10 minutes at room temperature and permeabilized with PBS-T (Ca2+/Mg2+-free PBS + 0.1% TWEEN® 20 (Cat# BP337-500 ...
-
bioRxiv - Physiology 2023Quote: ... fish were acclimatized for 4–5 days prior to the assay in a cylindrical assay chamber (325 mL glass dish, 10 cm × 5 cm, VWR, Radnor, PA, USA) filled with conditioned water (pH 6.8–7.0 ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS at pH 10 at room temperature on an orbital shaker set at 150 rpm (no. 57018-754VWR; VWR International, Brisbane, CA). After 48 h ...
-
bioRxiv - Neuroscience 2024Quote: ... 12 µg of plasmid DNA (ratio 1:10 for guide-RNA and dCas9-construct containing plasmids) was diluted into 5 µl of sterile 10 % glucose and added to diluted In vivo-jetPEI® reagent (#101000040 VWR, Polyplus-transfection). The solution was mixed by pipetting and incubated at RT for 15 min ...
-
bioRxiv - Immunology 2024Quote: ... at a concentration of 1x105 neurons/ml so that 1x105 neurons were seeded onto poly-D-lysine (10 µg/mL) coated acid-etched coverslips (VWR,, cat#MSPP-P06G1520F) and cultured at 37°C plus 5% CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Immunology 2022Quote: ... gentamycin (10 μg/ml for plasmid maintenance in E. coli; 100 μg/ml for plasmid maintenance in P. aeruginosa, VWR, Cat. No. 97062-974).
-
bioRxiv - Neuroscience 2023Quote: ... Elma Schmidbauer GmbH), mixed (10 min, 2035 rpm, HeidolphTM MultiReax) and centrifuged (1 min, 12300 RCF, Micro-Star 12, VWR®, Radnor, PA, USA). The total protein concentration in each sample was determined using the BCA assay in 10-20 μl sample aliquots ...
-
bioRxiv - Neuroscience 2023Quote: ... and stored at −20 °C in an anti-freeze solution (30 % glycerol [Merck Millipore, Germany], 30 % ethylene glycol [VWR International, USA] and 10 % TBS) until further processing ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Viable embryos at the 2-cell stage (0.75 hours post fertilization (hpf)) were sorted into 4 replicates of 10 embryos within 24-well plates (VWR international, LLC Radnor, PA, USA). Replicates were exposed to 1 mL of vehicle (0.1% DMSO ...
-
bioRxiv - Neuroscience 2024Quote: ... Microscope slides with serially sectioned nerves were rinsed in 1× PBS for 5 min (repeated twice) and air-dried by incubation at 70°C for 10 min in an oven (VWR Scientific, Model 1525 incubator). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris® RNA FISH Wash Buffer B was removed and samples were resuspended in Vectashield Antifade Mounting Medium with DAPI (VWR; Cat #: H-1200-10). Samples were then placed on a slide and sealed with a coverslip and nail polish.
-
bioRxiv - Microbiology 2019Quote: ... Diluted cells were plated onto fresh LB plates (15 ml medium per plate, the diameter of the plate is 10 cm and the height 15 mm, VWR, US, Catalog number 25384-342), and multiple dilutions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... in the transfer buffer (25 mM Tris base [Acros Organics 42457-1000], 192 mM glycine [Sigma-Aldrich G8898], and 10% v/v methanol [VWR BDH1135] in water) at 18 V for 50-70 min at room temperature using the Mini Gel system (Invitrogen NW2000) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and 100 U/mL penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730). For IFNγ (R&D Systems ...
-
bioRxiv - Biochemistry 2020Quote: α-syn seeds were generated by sonication of α-syn aggregates at different aggregation time points for 10 minutes in a water bath sonicator (VWR® Symphony™ Ultrasonic Cleaner). 5% (m/m ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-cell stage embryos were mounted on a thin (∼1-2x lab tape thickness) 2% agar pad on a glass slide (VWR VistaVision, 3 inches x 1 inch x 1 mm) using a hand-pulled glass pipette (VWR Pasteur Pipette ...
-
bioRxiv - Biophysics 2020Quote: ... Confocal Microscopy—HeLa cells grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips) were imaged 48 hours post transfection to maintain consistency with the FACS measurements ...
-
bioRxiv - Biophysics 2020Quote: ... U2OS cells were grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips). All CyTERM constructs were transiently transfected for 18–24 hours using Lipofectamine 3000 (Invitrogen ...