Labshake search
Citations for VWR :
901 - 950 of 1525 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... slow frozen using 2-methylbutane vapors (VWR, 103525-278) submerged in liquid nitrogen and stored at -80°C until use ...
-
bioRxiv - Cancer Biology 2024Quote: ... diluted in 10 mL DPBS containing 2% BSA (VWR), spun down at 250 g for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... and then transferred to 2 mL cryovials (VWR, Canada). The cryovials were then placed in a CoolCell (Corning ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μM PP2 (Avantor/VWR, stock diluted 1:25) was used as a positive control ...
-
bioRxiv - Cell Biology 2020Quote: ... Bone marrow was collected via centrifugation from the femur and tibia of 8-week-old male C57BL6/J mice and cultured in αMEM (VWR, Radnor, PA, USA) supplemented with 10% fetal bovine serum VWR ...
-
bioRxiv - Cancer Biology 2021Quote: 1×105 A549 or H460 cells in 200 µl of serum-free growth medium were seeded in the insert of a transwell plate with 8 μm pores (VWR International, Radnor, PA). These cells were coincubated with AvFc or CTX at 30 nM for 2 hours at 37 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... PCLS were then placed on Gelfoam® for long-term culture and monitored using a WST-8 cell counting kit (VWR #89155-898) according to the kit’s instructions ...
-
bioRxiv - Biophysics 2021Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared at 150 µM in a pre-warmed Tyrodes buffer (recipe given in (Hutchinson et al. ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/streptomycin (Wisent) ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 5% (v/v) heat inactivated fetal bovine serum (VWR). Cell line authentication was provided by the American Type Culture Collection ...
-
bioRxiv - Neuroscience 2023Quote: ... in mTeSR plus 10 μM ROCK inhibitor (VWR, cat. #688000-5). The 96 well-plate was then spun at 330 g for 5 minutes to aggregate the cells and make spheroids ...
-
bioRxiv - Cell Biology 2023Quote: ... were dried to a 5 mm coverslip (Mentzel Glasser #1, VWR) and mounted on the sample holder using vacuum grease (Dow Corning high vacuum grease ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared in aqueous Tyrodes buffer (Hutchinson et al. ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/ streptomycin (Wisent).
-
bioRxiv - Biophysics 2023Quote: ... and nuclease-free water (#7732-18-5) from VWR (Vienna, Austria). 14C-malic acid was purchased either from Perkin Elmer (Waltham ...
-
bioRxiv - Neuroscience 2024Quote: ... embedded in 5% low-gelling temperature agarose (VWR International, Erlangen, Germany), placed in ice-cold oxygenated S2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The incision was sutured with 5-0 Vicryl (VWR, 95056-936) with application of topical bacitracin ...
-
bioRxiv - Molecular Biology 2023Quote: ... then neutralized with 1 μL 5 M HCl (VWR BDH7419-1). The remainder of the library preparation was performed according to the xGen protocol except that post-ligation ...
-
bioRxiv - Biochemistry 2022Quote: ... 5-10% inactivated fetal bovine serum (FBS; VWR Canada #97068-085) was added and the stock was stored at 4°C.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-10% inactivated fetal bovine serum (FBS; VWR Canada #97068-085) was added and the stock was stored at 4°C.
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% uranyl acetate and 5% H2O in anhydrous acetone (VWR, Germany) pre-cooled to −90 °C .The FS was performed in a Leica AFS2 (Leica ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/streptomycin (Wisent) ...
-
bioRxiv - Biochemistry 2024Quote: ... and then diluted to 5% nitric acid with OmniTrace water (VWR). To test for mineral contamination ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% milk in 1x TBS with 0.1% Tween 20 (VWR, 0777) was used for blocking and antibody dilution ...
-
bioRxiv - Biochemistry 2021Quote: For transductions VeroE6 or HEK cells were seeded into greiner CELLSTAR® 96-well plates or 6-well plates (VWR) containing lentivirus in DMEM containing 2 % FBS and 1 μg/mL polybrene ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then subcultured 1:1000 into 7 mL of MSgg in a 6-well polyvinyl plate (VWR, PA, USA). Plates were incubated in static conditions at 30°C for 3 days and were then imaged using a Leica MZ10F macroscope and Leica DMC2900 camera ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Microbiology 2022Quote: ... The in-house polyacrylamide TBE gels (40 ml) for horizontal electrophoresis were produced by combining 6 ml 40% Acryl/Bis 29:1 (VWR), 4 ml of 5x TBE ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures for experiments were grown in flat-bottom 3 L polycarbonate Erlenmeyer flasks (VWR, Germany) at 22-25 °C ...
-
bioRxiv - Bioengineering 2020Quote: ... (3) we then pipette the solutions vigorously in a 20 mL scintillation glass vial (VWR) with a hydrophobic coating which is introduced by incubation with Rain-X (ITW Global Brands ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected for five days in presence of 3 μg/ml puromycin (VWR, CAYM13884). A near 100% GFP-positive population was confirmed via microscopy (ZOE Fluorescent Cell Imager ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescence intensity (∼485 nm/∼530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR).
-
bioRxiv - Cell Biology 2024Quote: Holes were punched using a Harris uni-core 3 mm biopsy puncher (VWR, 89022-356), followed by air drying with a nitrogen gun ...
-
bioRxiv - Immunology 2024Quote: ... the peritoneal cavity was washed out using 3 mL of 0.9 % NaCl solution (VWR, 5929.1000) containing 1 mg/mL EDTA (VWR ...
-
bioRxiv - Neuroscience 2024Quote: ... then the adjacent 3 sections of 10 micron tissue were collected on microscope slides (VWR SuperFrost Microscope Slides ...
-
bioRxiv - Bioengineering 2024Quote: ... dendriplex solutions were vortexed for 10 seconds at medium speed (velocity 3, VV3 vortex, VWR) followed by an incubation of 30 minutes at room temperature (RT) ...
-
GRASP55 Safeguards Proper Lysosome Function by Controlling Sorting of Lysosomal Enzymes at the GolgibioRxiv - Cell Biology 2024Quote: ... Cleared culture supernatants were concentrated using 3 kDa cut-off concentrator tubes (#516-0227P, VWR) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Immunology 2022Quote: Splenic T-lymphocytes were counted and plated at an optimal seeding density of 8×104 cells per 100 µL in 96 well Microtitration ImageLock plates (VWR, #4379, Radnor, PA, USA). The cells were cultured with anti-CD3 and anti-CD28 activation beads and imaged over the course of 96hrs in the Essen Bioscience IncuCyte S3 Live-Cell imager and analysis system.
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine (BioWhittaker) and 10% bovine calf serum (VWR). Cos-7 cells (a gift of Dr ...