Labshake search
Citations for VWR :
851 - 900 of 1686 citations for 7 chloro 5 2 fluorophenyl 4 hydroxy 3H 1 4 benzodiazepin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 100 μg/mL of 5-florocystosine (5-FC) and grown at 24°C as listed in Supplemental Table S1 (Stork et al. 2008) (VWR, Radnor, PA, USA). A 10 mg/mL stock solution of 5-FC was prepared in distilled water and filtered sterilized ...
-
bioRxiv - Physiology 2023Quote: ... fish were acclimatized for 4–5 days prior to the assay in a cylindrical assay chamber (325 mL glass dish, 10 cm × 5 cm, VWR, Radnor, PA, USA) filled with conditioned water (pH 6.8–7.0 ...
-
bioRxiv - Microbiology 2019Quote: ... with 5% fetal bovine serum (FBS) (VWR Seradigm, Radnor, PA), 1X Penicillin/Streptomycin/Glutamine (P/S/G ...
-
bioRxiv - Biochemistry 2020Quote: ... in house packed) using 5 to 50% acetonitrile gradient (VWR) with a flowrate of 250 nl/min (Eksigent nano-LC Ultra) ...
-
bioRxiv - Microbiology 2020Quote: ... 5% heat-inactivated fetal bovine essence (FBE) (VWR, 10805-184) for Vero cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 mM EDTA) using a Bead Mill Homogenizer (VWR). Extraction of proteins were performed as described (27) ...
-
bioRxiv - Genomics 2021Quote: ... cells were blocked with 5% BSA (VWR, Cat# 97061-420) in PBST at RT for 30 min with gentle shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... and GRK 5 using Jetprime transfection reagent (VWR 76299-630) and plated on poly-D-lysine-coated coverslips in a 6-well plate ...
-
bioRxiv - Cell Biology 2022Quote: ... Stable cells were selected with 5 µg/ml puromycin (VWR) in complete DMEM for 3 days and subsequently maintained in complete DMEM plus 3 µg/ml puromycin ...
-
bioRxiv - Developmental Biology 2023Quote: ... stained with 5 mg/mL neutral red (VWR, Radnor, PA) in PBS for 10 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Ethanol absolute (64-17-5) was purchased from VWR (PA). LIVE/DEAD™ Cell Imaging Kit (488/570 ...
-
bioRxiv - Genomics 2024Quote: ... and vortexed at speed 3 (∼600rpm) for 5 minutes (VWR Analog Vortex Mixer ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 5 % fetal bovine serum ([FBS], Avantor Seradigm, VWR). Human embryonic kidney 293 cells expressing the SV40 T-antigen ([HEK-293T] ...
-
bioRxiv - Cell Biology 2019Quote: ... Single cells were sorted into 200 μL fresh culture medium in one well of a 96-well flat bottom plate (VWR Catalog #29442-054).
-
bioRxiv - Biochemistry 2019Quote: ... pelagicus F5 (5 mg) dissolved in D2O (600 µL; VWR, Brazil) containing TMSP (0.003% v/v ...
-
bioRxiv - Biophysics 2021Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared at 150 µM in a pre-warmed Tyrodes buffer (recipe given in (Hutchinson et al. ...
-
bioRxiv - Immunology 2022Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/streptomycin (Wisent) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5% w/v RNase free BSA solution (VWR, No. 0332-25G) is poured over the paper ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 5% (v/v) heat inactivated fetal bovine serum (VWR). Cell line authentication was provided by the American Type Culture Collection ...
-
bioRxiv - Biochemistry 2022Quote: ... 5-10% inactivated fetal bovine serum (FBS; VWR Canada #97068-085) was added and the stock was stored at 4°C.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared ...
-
bioRxiv - Neuroscience 2023Quote: ... in mTeSR plus 10 μM ROCK inhibitor (VWR, cat. #688000-5). The 96 well-plate was then spun at 330 g for 5 minutes to aggregate the cells and make spheroids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared in aqueous Tyrodes buffer (Hutchinson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-10% inactivated fetal bovine serum (FBS; VWR Canada #97068-085) was added and the stock was stored at 4°C.
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% uranyl acetate and 5% H2O in anhydrous acetone (VWR, Germany) pre-cooled to −90 °C .The FS was performed in a Leica AFS2 (Leica ...
-
bioRxiv - Biophysics 2023Quote: ... and nuclease-free water (#7732-18-5) from VWR (Vienna, Austria). 14C-malic acid was purchased either from Perkin Elmer (Waltham ...
-
bioRxiv - Microbiology 2024Quote: ... we added 5 mL of 1X Phosphate Buffered Saline solution (VWR) to the samples and centrifuged them (17,000 x g ...
-
bioRxiv - Cancer Biology 2024Quote: ... The incision was sutured with 5-0 Vicryl (VWR, 95056-936) with application of topical bacitracin ...
-
bioRxiv - Neuroscience 2024Quote: ... embedded in 5% low-gelling temperature agarose (VWR International, Erlangen, Germany), placed in ice-cold oxygenated S2 ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/ streptomycin (Wisent).
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 × 104 of RPE1 cells were plated on PLL coated coverslips (VWR) one day before quiescence induction and 3 × 104 cells were plated for proliferating condition.
-
bioRxiv - Biochemistry 2022Quote: ... The membrane was blocked with 5% bovine serum albumin (VWR, Batavia, IL) in PBS containing 0.1% Tween-20 for one hour at room temperature and then incubated in primary antibodies overnight at 4 °C ...
-
bioRxiv - Physiology 2021Quote: ... Sections were blocked with 5% donkey serum in 0.3% Tween20 (VWR, 437082Q) in PBS (PBST ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plates were developed for 5 minutes with TMB substrate (VWR 95059-286), with development stopped with an equal volume of 2 N sulfuric acid and plates read at 450 nm ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Remaining biofilm was removed and homogenized with glass beads (5 mm, VWR International AG ...
-
bioRxiv - Genetics 2020Quote: ... 5 μL of 1.25 mg/mL zymolyase-100T (VWR IC320932; Radnor, PA) was used during the spheroplasting ...
-
bioRxiv - Bioengineering 2022Quote: ... cell culture media supplemented with 5% heat-inactivated fetal bovine serum (VWR) and penicillin/streptomycin (Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... blocked for 1hr at RT with 5% normal donkey serum (NDS, VWR) in PBS with 0.25% Triton-X (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... which were then blocked in a 5% BSA (VWR, 9048-46-8) solution made in 1x TBST buffer (20 mM Tris base ...
-
bioRxiv - Cancer Biology 2023Quote: ... or non-treated 6 well plates (VWR 10861-554. 5 ml/well) and incubated for four days in a 37°C oven ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5-min immersion in Form Wash using isopropanol (Cat. #: 20922.320, VWR) was used as the solvent to remove the unpolymerized resin from the surface of the printed parts ...
-
bioRxiv - Developmental Biology 2024Quote: ... After 5 washes of 30 min with PBS-triton 0.8% (28817295, VWR), larvae were incubated with the secondary antibody using 1% goat serum (16210064 ...
-
bioRxiv - Molecular Biology 2024Quote: ... in PBS and blocked with 5% IgG-free BSA (VWR, 102643-516) in PBS ...
-
bioRxiv - Biophysics 2021Quote: ... a dauer suspension of 5 μl was pipetted onto a coverslip (VWR International) and exposed to 98% RH (relative humidity ...
-
bioRxiv - Cancer Biology 2019Quote: ... in Roswell Park Memorial Institute (RPMI)-1640 medium supplemented with 5% FBS (VWR Life Science Seradigm ...
-
bioRxiv - Neuroscience 2020Quote: ... Adeno-associated viruses (AAVs) were infused with calibrated 5 µl glass pipettes (VWR) pulled to have a tip diameter of 3 µm ...
-
bioRxiv - Genomics 2019Quote: ... and 5 min at 70 °C on a UnoCycler 1200 (VWR, Radnor, USA). Quantitative PCR was conducted on a Rotorgene Q (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Adeno-associated viruses (AAVs) were infused with calibrated 5 µl glass pipettes (VWR) pulled to have a tip diameter of 3 µm ...