Labshake search
Citations for VWR :
851 - 875 of 875 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... gentamycin (10 μg/ml for plasmid maintenance in E. coli; 100 μg/ml for plasmid maintenance in P. aeruginosa, VWR, Cat. No. 97062-974).
-
bioRxiv - Neuroscience 2023Quote: ... Elma Schmidbauer GmbH), mixed (10 min, 2035 rpm, HeidolphTM MultiReax) and centrifuged (1 min, 12300 RCF, Micro-Star 12, VWR®, Radnor, PA, USA). The total protein concentration in each sample was determined using the BCA assay in 10-20 μl sample aliquots ...
-
bioRxiv - Neuroscience 2023Quote: ... and stored at −20 °C in an anti-freeze solution (30 % glycerol [Merck Millipore, Germany], 30 % ethylene glycol [VWR International, USA] and 10 % TBS) until further processing ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Viable embryos at the 2-cell stage (0.75 hours post fertilization (hpf)) were sorted into 4 replicates of 10 embryos within 24-well plates (VWR international, LLC Radnor, PA, USA). Replicates were exposed to 1 mL of vehicle (0.1% DMSO ...
-
bioRxiv - Neuroscience 2024Quote: ... Microscope slides with serially sectioned nerves were rinsed in 1× PBS for 5 min (repeated twice) and air-dried by incubation at 70°C for 10 min in an oven (VWR Scientific, Model 1525 incubator). Next ...
-
bioRxiv - Biophysics 2021Quote: ... were washed with 200 μL PBS/0.2 mM DDM and incubated with 4 μg RHO 1D4 antibody (University of British Columbia) in 50 μL PBS/0.2 mM DDM on a ferris wheel (VWR, 30 min). After washing the beads PBS/0.2 mM DDM (with 200 μL) ...
-
bioRxiv - Genomics 2020Quote: Single cell suspensions in PBS with 2% FBS were stained by incubating for 15 minutes at room temperature protected from light with anti-human PTPRC (CD45) monoclonal antibody conjugated to FITC (1:200 dilution, VWR #ABNOMAB12230), anti-human EPCAM antibody conjugated to PE (1:50 dilution ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were diluted in PBS with 2% FBS and samples were stored in PBS containing 1% formaldehyde (VWR Life Science AMRESCO). For intracellular staining ...
-
bioRxiv - Microbiology 2023Quote: ... A surface capture lawn was prepared with 50 ug/mL of goat anti-Human IgG Fc secondary antibody (VWR, 103255-066) in 10 mM sodium acetate (pH 4.5)/0.01% Tween ...
-
bioRxiv - Genomics 2023Quote: ... then incubated on rollers at room temperature for 1 hour with an anti-mouse secondary antibody conjugated to horseradish peroxidase (VWR, NXA931). After four further washes for 10 min each (2 x blocking buffer ...
-
bioRxiv - Neuroscience 2024Quote: Detection with 3,3′-diaminobenzidine (DAB) was performed using horseradish peroxidase labeled secondary antibodies and DAB Quanto chromogen and substrate (VWR, Radnor, PA).
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris® RNA FISH Wash Buffer B was removed and samples were resuspended in Vectashield Antifade Mounting Medium with DAPI (VWR; Cat #: H-1200-10). Samples were then placed on a slide and sealed with a coverslip and nail polish.
-
bioRxiv - Microbiology 2019Quote: ... Diluted cells were plated onto fresh LB plates (15 ml medium per plate, the diameter of the plate is 10 cm and the height 15 mm, VWR, US, Catalog number 25384-342), and multiple dilutions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... in the transfer buffer (25 mM Tris base [Acros Organics 42457-1000], 192 mM glycine [Sigma-Aldrich G8898], and 10% v/v methanol [VWR BDH1135] in water) at 18 V for 50-70 min at room temperature using the Mini Gel system (Invitrogen NW2000) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and 100 U/mL penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730). For IFNγ (R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated with secondary antibodies and DAPI for 2 hr at room temperature prior to mounting in AquaPoly/Mount mounting medium (VWR, 87001-902).
-
bioRxiv - Bioengineering 2024Quote: ... AB_11125142) or an anti-mouse secondary antibody (1:3000, Cat# 170-6516, RRID: AB_11125547) and enhanced chemiluminescence reagent (VWR, Cat # 490005-018). The signal was visualized using a C-DiGit Blot Scanner (Li-Cor) ...
-
bioRxiv - Biochemistry 2020Quote: α-syn seeds were generated by sonication of α-syn aggregates at different aggregation time points for 10 minutes in a water bath sonicator (VWR® Symphony™ Ultrasonic Cleaner). 5% (m/m ...
-
bioRxiv - Microbiology 2023Quote: ... infectivity and spread cells were stained with a SARS-CoV-2 anti-N rabbit polyclonal antibody for 1 hour followed by 594-conjugated secondary Goat anti-Rabbit IgG (VWR, GtxRb-003-D594NHSX) for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... transfected and infected cells were stained with an anti-N rabbit polyclonal antibody followed by incubation with secondary 594-conjugated Goat anti-Rabbit IgG (VWR, GtxRb-003-D594NHSX). Nuclei were stained with DAPI (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... and cells were incubated with primary antibodies against the pre- and post-synaptic markers of interest overnight at 4°C in antibody incubation buffer (150 mM NaCl, 50 mM Tris-Base (VWR, Cat# 101174-856), 1% BSA ...
-
bioRxiv - Biophysics 2020Quote: ... Confocal Microscopy—HeLa cells grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips) were imaged 48 hours post transfection to maintain consistency with the FACS measurements ...
-
bioRxiv - Biophysics 2020Quote: ... U2OS cells were grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips). All CyTERM constructs were transiently transfected for 18–24 hours using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... was used to stain nucleic acids following washing away unbound secondary antibodies and samples were covered with VectaShield anti-fade reagent (Vector Laboratories, VWR, Cat# 101098-048) and a coverslip ...