Labshake search
Citations for VWR :
751 - 770 of 770 citations for 10 UNDECENYLDIMETHYLCHLOROSILANE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... fish were acclimatized for 4–5 days prior to the assay in a cylindrical assay chamber (325 mL glass dish, 10 cm × 5 cm, VWR, Radnor, PA, USA) filled with conditioned water (pH 6.8–7.0 ...
-
bioRxiv - Bioengineering 2023Quote: ... in PBS at pH 10 at room temperature on an orbital shaker set at 150 rpm (no. 57018-754VWR; VWR International, Brisbane, CA). After 48 h ...
-
bioRxiv - Microbiology 2023Quote: ... and the cells were resuspended in 5 mL of methanol/dichlormethane/ethylacetate 10:2:3 (dichlormethane: SupraSolv, VWR Chemicals, Dresden, Germany; ethylacetate, HiPerSolv Chromanorm, VWR Chemicals, Dresden, Germany). The suspensions were sonicated (5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 12 µg of plasmid DNA (ratio 1:10 for guide-RNA and dCas9-construct containing plasmids) was diluted into 5 µl of sterile 10 % glucose and added to diluted In vivo-jetPEI® reagent (#101000040 VWR, Polyplus-transfection). The solution was mixed by pipetting and incubated at RT for 15 min ...
-
bioRxiv - Immunology 2024Quote: ... at a concentration of 1x105 neurons/ml so that 1x105 neurons were seeded onto poly-D-lysine (10 µg/mL) coated acid-etched coverslips (VWR,, cat#MSPP-P06G1520F) and cultured at 37°C plus 5% CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: Primary OSE cultures and the OSN2 cell line (Flesken-Nikitin et al. 2003) were maintained in culture in media containing DMEM (VWR; Cat#: 10-017-CM), Hams F12 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2020Quote: ... was mixed with deuterium oxide (450 µl) containing sodium formate (1 µmol/L) and then passed through a 10 KDa cutoff centrifugal filter (VWR, Radnor, PA, United States). 1H-NMR spectra were acquired using a 600 MHz spectrometer (Bruker AVANCE II ...
-
bioRxiv - Immunology 2022Quote: ... gentamycin (10 μg/ml for plasmid maintenance in E. coli; 100 μg/ml for plasmid maintenance in P. aeruginosa, VWR, Cat. No. 97062-974).
-
bioRxiv - Neuroscience 2023Quote: ... Elma Schmidbauer GmbH), mixed (10 min, 2035 rpm, HeidolphTM MultiReax) and centrifuged (1 min, 12300 RCF, Micro-Star 12, VWR®, Radnor, PA, USA). The total protein concentration in each sample was determined using the BCA assay in 10-20 μl sample aliquots ...
-
bioRxiv - Neuroscience 2023Quote: ... and stored at −20 °C in an anti-freeze solution (30 % glycerol [Merck Millipore, Germany], 30 % ethylene glycol [VWR International, USA] and 10 % TBS) until further processing ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Viable embryos at the 2-cell stage (0.75 hours post fertilization (hpf)) were sorted into 4 replicates of 10 embryos within 24-well plates (VWR international, LLC Radnor, PA, USA). Replicates were exposed to 1 mL of vehicle (0.1% DMSO ...
-
bioRxiv - Neuroscience 2024Quote: ... Microscope slides with serially sectioned nerves were rinsed in 1× PBS for 5 min (repeated twice) and air-dried by incubation at 70°C for 10 min in an oven (VWR Scientific, Model 1525 incubator). Next ...
-
bioRxiv - Molecular Biology 2021Quote: ... Stellaris® RNA FISH Wash Buffer B was removed and samples were resuspended in Vectashield Antifade Mounting Medium with DAPI (VWR; Cat #: H-1200-10). Samples were then placed on a slide and sealed with a coverslip and nail polish.
-
bioRxiv - Microbiology 2019Quote: ... Diluted cells were plated onto fresh LB plates (15 ml medium per plate, the diameter of the plate is 10 cm and the height 15 mm, VWR, US, Catalog number 25384-342), and multiple dilutions were used ...
-
bioRxiv - Cell Biology 2021Quote: ... in the transfer buffer (25 mM Tris base [Acros Organics 42457-1000], 192 mM glycine [Sigma-Aldrich G8898], and 10% v/v methanol [VWR BDH1135] in water) at 18 V for 50-70 min at room temperature using the Mini Gel system (Invitrogen NW2000) ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% fetal bovine serum (X&Y Cell Culture, Cat# FBS-500, Lot# 7B0302) and 100 U/mL penicillin/streptomycin (VWR Life Sciences, Cat# 82026-730). For IFNγ (R&D Systems ...
-
bioRxiv - Biochemistry 2020Quote: α-syn seeds were generated by sonication of α-syn aggregates at different aggregation time points for 10 minutes in a water bath sonicator (VWR® Symphony™ Ultrasonic Cleaner). 5% (m/m ...
-
bioRxiv - Biophysics 2020Quote: ... Confocal Microscopy—HeLa cells grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips) were imaged 48 hours post transfection to maintain consistency with the FACS measurements ...
-
bioRxiv - Biophysics 2020Quote: ... U2OS cells were grown in 35 mm imaging dishes (made in-house from Corning 35 x 10 mm dishes with VWR 18 x 18 mm #1.5 cover slips). All CyTERM constructs were transiently transfected for 18–24 hours using Lipofectamine 3000 (Invitrogen ...