Labshake search
Citations for VWR :
551 - 600 of 1530 citations for 7 CHLORO 2H PYRIDO 2 3 B 1 4 OXAZIN 3 4H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Then the cultures were stained with 4 µM Hoechst 33342 (PI62249, VWR) in PBS for 10 min before imaging on Opera Phenix high-content microscope (PerkinElmer ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were fixed for 30 min in 4 % formaldehyde (16 % VWR 100503) diluted in pH 7.0 PBS ...
-
bioRxiv - Immunology 2020Quote: ... cells were fixed overnight using 4% formaldehyde made in PBS (VWR, Sweden). The broad extended panel of antibodies used for staining are listed in Supplementary Table 1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Brains were embedded in 4% Agarose (#9012366, VWR Life Science, Hannover, Germany) and were cut into 100 ...
-
bioRxiv - Immunology 2022Quote: ... the bound EVs were fixed with 4% paraformaldehyde (Cat. No. 20909.290, VWR) for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... murine colon rolls were fixed in 4%(w/v) PFA (VWR International), equilibrated in 30%(w/v ...
-
bioRxiv - Neuroscience 2023Quote: ... were first fixed in a 4% paraformaldehyde solution (PFA, VWR, #100503 917). They were then prepped for staining by blocking in 1× PBS ...
-
bioRxiv - Bioengineering 2022Quote: The scaffolds used for microscopy were fixed with 4% Paraformaldehyde (PFA) (VWR) for 1 hour and subsequently placed in PBS until further processing ...
-
bioRxiv - Molecular Biology 2024Quote: ... The tumour pieces used for IF were fixed in 4% formol (VWR) for 45 min at RT and were then placed in cryovials at -25°C for 45 min to freeze ...
-
bioRxiv - Neuroscience 2024Quote: ... primary neurons were fixed using ice-cold paraformaldehyde (4% in PBS, VWR) for 10 min at 4 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Fixations were performed at room temperature with 4% paraformaldehyde (CA11021-168, VWR) in PBS for 20 minutes on a rotating platform followed by washing in PBS twice before staining ...
-
bioRxiv - Microbiology 2020Quote: ... Separately sterilized 2% D-(+)-glucose monohydrated (VWR Chemicals, Germany) was added to the medium ...
-
bioRxiv - Bioengineering 2020Quote: ... and coated overnight in 2 mg/mL BSA (VWR) at RT ...
-
bioRxiv - Bioengineering 2019Quote: ... 170 µm thickness (VWR micro cover glass No. 2), are adhered to the surface with Norland 60 Optical Adhesive and then coated in 150 nm of aluminum by Lesker physical vapor deposition (PVD) ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to a 2 mL homogenizer (VWR International). To generate synaptosomes ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine and 10% bovine calf serum (VWR) was used during live imaging processes.
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2% Proteinase K (20 mg/ml, VWR) was added per 1 g of tissue ...
-
bioRxiv - Systems Biology 2020Quote: ... supplemented with 2% Fetal Calf Serum (VWR #89510-184). After 16h ...
-
bioRxiv - Immunology 2020Quote: ... Slides were incubated in 2% sodium borohydride (VWR, BDH4604) in PBS for 40 minutes at RT to remove auto fluorescence ...
-
bioRxiv - Immunology 2022Quote: ... Cells were fixed in 2% paraformaldehyde (VWR International, Inc.) to assess pan-immune cells in Fig ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL 5x SYBR green (VWR, CN 12001-796), and 1.4 µL nuclease-free water ...
-
bioRxiv - Neuroscience 2022Quote: ... cleared in a solution of xylene (2 min; VWR, International ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR bands were visualized on 2% agarose (VWR, 97062) in TBE (VWR ...
-
bioRxiv - Biochemistry 2023Quote: ... with 5% 2-mercaptoethanol (VWR Life Science #M131-100ml) and then ran on 4-20% Criterion TGX pre-cast gels (Bio-Rad #5671093) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM phenylmethylsulfonyl fluoride (VWR Life Science, Radnor, PA) and the protease inhibitor cocktail ...
-
The T-cell niche tunes immune function through modulation of the cytoskeleton and TCR-antigen forcesbioRxiv - Bioengineering 2024Quote: ... 2 Glass Coverslips (# 48382-085) were purchased from VWR. RNeasy mini prep kit (# 74106 ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... After 10 min of fixation using 4% neutral buffered formaldeyde (VWR, Darmstadt, Germany), the cell count was assessed by DAPI-staining (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... 24 hours post-transfection cells were fixed in 4% paraformaldehyde (VWR, AAJ61899-AK) for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... the larvae were initially fixed by immersion in 4% paraformaldehyde (VWR:15713-S) /0.1M sodium-cacodylate (VWR:11653) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were fixed with ice cold 4 % paraformaldehyde (PFA)(43368.9M, VWR Stockholm Sweden) and for 15 min and permeabilized with 0.1 % (w/v ...
-
bioRxiv - Immunology 2022Quote: ... Human colon tissue samples were fixed in 4%(w/v) PFA (VWR International) for 24h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed (4% formaldehyde, VWR International, in PBS; 10 min. at RT), washed (2 × 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... jejunum and ileum and fixed overnight (ON) at 4°C in formalin (VWR), a 4% formaldehyde solution buffered to pH 6.9 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were briefly fixed in 4% paraformaldehyde (PFA, VWR, Cat # AA-A11313-36) in phosphate buffered saline (PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were washed 4 times with 0.1% NP-40 substitute (VWR, 97064-730) in tris-buffered saline (TBS) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were fixed with 4% formaldehyde stabilized with 0.5-1.5% methanol (VWR, 9713) for 12 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Equal volumes (20 μL) of the cell suspension and 4% trypan blue (VWR) were gently mixed ...
-
bioRxiv - Neuroscience 2024Quote: ... We fixed the cells with 600 µL of 4% paraformaldehyde solution (VWR International) in PBS for 15 min and washed them with PBS three times ...
-
bioRxiv - Neuroscience 2024Quote: ... and cooling to 4°C using a thermocycler (Avantor VWR, Radnor, PA, USA). All primers were originally designed using NCBI primer blast software ...
-
bioRxiv - Plant Biology 2024Quote: ... Cultures were grown under constant shaking (VWR shaker model 3500, shaker setting 4), 18°C ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine (BioWhittaker) and 10% bovine calf serum (VWR). Cos-7 cells (a gift of Dr ...
-
bioRxiv - Immunology 2023Quote: ... The samples were stored in 2 ml ethanol (VWR, 20821.330P). Clean and fire-sterilized scissors and forceps were used for each intestinal section to minimise bacterial DNA contamination ...