Labshake search
Citations for VWR :
551 - 600 of 1227 citations for 6 METHYL 2H PYRIDO 1 2 A PYRIMIDIN 2 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Jag1-Fc was immobilized by overnight incubation at 4°C in individual wells of non-tissue culture-treated 6 or 12 well plates (VWR) at a final concentration of 2 µg/mL in DPBS containing 10 µg/mL poly-D-lysine (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: Monocytes were isolated as described above and 3×106 cells/ml were plated in a 6-well plate using RPMI-1640 medium (#392-0427, VWR) supplemented with 10% FBS (#11573397 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2021Quote: ... and a dye photosensitizer in N,N-dimethylformamide/acetone (7/3, v/v) was electrospun onto one layer of polypropylene (PP) fabrics (VWR® Basic Protection Face Mask). During the electrospinning of 10-20 wt% of PVDF ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Immunology 2020Quote: ... equal numbers of cells were counted by Moxi Mini automated cell counter (Orflo) and 0.6×10^6 cells per data point were seeded in T-25 cell culture flasks (VWR, PA, USA) in appropriate volume of culture medium ...
-
bioRxiv - Microbiology 2022Quote: ... PS01156 or both PS01155 and PS01156 (∼6*107 CFU/ml) in polypropylene conical tubes (cat. no. 89039-670, VWR, Radnor, PA) in BHI broth ...
-
bioRxiv - Molecular Biology 2023Quote: ... animals of the indicated genotype were washed out of wells on a 6-well plate at the indicated timepoints with M9+0.05% gelatin (VWR, 97062-620), transferred to a 1.5 ml tube and washed twice more with M9+0.05% gelatin ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 mM imidazole and 200 mM NaCl was added before loading on a self-packed 3 ml Ni Sepharose™ 6 Fast Flow (VWR) column using ÄKTA Pure FPLC system (Cytiva ...
-
bioRxiv - Neuroscience 2019Quote: ... Our CAFÉ assay consisted of a 6-well plate with 4 small holes drilled for the insertion of pipette tips and 20 µl capillaries (VWR, Radnor, PA). Capillaries were filled via capillary action ...
-
bioRxiv - Neuroscience 2019Quote: ... with glass pipettes with open tip resistance of 3-6 MΩ (TW150F-3, World Precision Instruments, & 100µL calibrated pipettes #534332-921,VWR International). The bath solution consisted of ACSF ...
-
bioRxiv - Cancer Biology 2022Quote: Splenocytes were isolated from the spleen of 6-10-week-old OT-I male mice and pulsed with 2ug/ml of OVA peptide SIINFEKL (VWR, H-4866.0001BA) for 4 h in T cell culture media composed of RPMI1640 (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... were transfected into single wells (3.5 cm) of the Corning Costar 6-well cell culture plate containing HEK293T/17 cells using the JetPrime Transfection reagent (VWR, Randor, PA) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... each organoid was cut into 6 pieces using needles and subjected to shaking culture at 120 rpm (VWR Orbital Shaker Model 1000) in KR5 medium to develop cysts ...
-
bioRxiv - Cell Biology 2022Quote: ... 400,000 cells were seeded on ethanol-sterilised coverslip in 6 well 3.5 cm diameter plate containing 22 × 22 mm glass coverslips (VWR. Cat# 631-0125). 2 μg of DNA and 6 μg of PEI were diluted in 0.25 ml of Opti-MEM™ Reduced serum medium (Gibco™) ...
-
bioRxiv - Cell Biology 2023Quote: Lyophilized liver samples were homogenized in 10 mM phosphate buffer at pH 6 (28 mg tissue per ml buffer) on a bead beater (VWR, Radnor, PA) for 1 min ...
-
bioRxiv - Microbiology 2024Quote: ... 200 µL of the bacteria were pipetted on 6 cm NGM plates and evenly spread across the agar plate using a sterile L spreader (VWR 490007-358). Bacterial plates were left to dry in a laminar flow hood for 2 days ...
-
bioRxiv - Microbiology 2021Quote: GC-376 (CAS: 1416992-39-6) was purchased from Enovation chemicals (Green book, NY) and dissolved in deionized water (HyClone, VWR, West Chester, PA) to the desired concentration.
-
bioRxiv - Genomics 2022Quote: ... HeLa S3 or HeLa S3 + TOP2A- Venus cell linescells were either grown or spun onto 22×22mm No 1.5 coverslips in 6-well plates (VWR Cat No 48366-277). (cell cycle analysis experiments ...
-
bioRxiv - Biophysics 2024Quote: ... 293T/17 cells were plated in complete DMEM at 8 × 105 cells per well in a 6-well plate with an autoclaved glass coverslip (VWR, no. CLS-1760-025) to ensure 80% confluency on the day of the experiment ...
-
bioRxiv - Physiology 2021Quote: ... and this portion was placed on top of a stack of 4-6 glass microscopy slides (depending on size of animal) (VWR, Radnor PA-Cat. No. 48300-026). Tissue was secured onto glass slide with a biorthogonal silicon elastomer (Kwik-Sil ...
-
bioRxiv - Microbiology 2023Quote: ... Six to seven grams (6 ml) of soil was transferred to each well of the 12-well microtiter plates (VWR American cat no.:10861-556, USA), containing three one-millimeter holes in the bottom of all wells for drainage ...
-
bioRxiv - Plant Biology 2020Quote: 1-Aminocyclopropane-1-carboxylic acid (ACC; VWR P10007) was dissolved in sterile water (10 mM stock ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1 (VWR) were cleaned by a 20 minute exposure in a 2.6 L Zepto plasma laboratory unit (Diener Electronic) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Matrigel Basement Membrane Matrix (1:1) (354234, VWR).
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit anti-S100 1:300 (VWR/ProteinTech 15146-1-AP), Chick anti-Neurofilament 200 kDa 1:500 (Aves NFH) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1% DMSO (VWR) and 0.2 mM 1-phenyl-2-thiourea (Acros Organics ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1% BSA (VWR) and 0.1% Tween 20 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... the virus suspension was mixed 1:1 with peqGOLD TriFast (VWR). Following ...
-
bioRxiv - Molecular Biology 2023Quote: ... then neutralized with 1 μL 5 M HCl (VWR BDH7419-1). The remainder of the library preparation was performed according to the xGen protocol except that post-ligation ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and then 1 hour in 1:1 ratio of 30% sucrose/0.1M phosphate buffer:OCT (VWR, Cat No. 25608-930). Tissue was embedded inside a mold made by the severed end of a 1.5mL microcentrifuge tube attached to a glass slide with nail polish and stored at −80°C until used ...
-
bioRxiv - Molecular Biology 2021Quote: ... and G418 sulfate (500 μg mL−1, from 50 mg mL−1 stock in H2O, from 712 U mg−1 powder, VWR). Cells were checked monthly for mycoplasma contamination by PCR assay ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the mouse MF20 (1:500, DSHB), the rabbit anti-GFP (1:1000, Life technology) and the rabbit RFP (1:1000, VWR) primary antibodies ...
-
bioRxiv - Biophysics 2020Quote: ... 1% (w/w) 10:1 (base/crosslinker w/w) Sylgard-184 (VWR) was added to the GEL-8100 and mixed well for 60 seconds ...
-
bioRxiv - Molecular Biology 2023Quote: ... Each sample was homogenised in 1 mol.L-1 HCl (VWR, United States). Free glucose content was measured at this stage ...
-
bioRxiv - Immunology 2023Quote: ... HOIP (VWR/Proteintech 16298-1-AP, SHARPIN (VWR/Proteintech 14626-1-AP), and actin (Sigma-Aldrich A5316 ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-S100 Beta (VWR/Protein Tech #15146-1-AP, 1:300), mouse anti-NeuN (Sigma # MAB377 ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-S100 Beta (VWR/Protein Tech #15146-1-AP, 1:300), rabbit anti-dsRed (Takara #632496 ...
-
bioRxiv - Cell Biology 2024Quote: ... Each sample was homogenized in 1 mol.L-1 HCl (VWR, United States) and free glucose content was measured ...
-
bioRxiv - Genetics 2021Quote: ... 1 mM Squalene (VWR), 50 µM Lanosterol (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1% BSA (421501J, VWR), 0.1% Triton-X and 0.05% Tween-20 in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 mM MgCl2 (VWR), 1% Triton X-100 (Alfa Aesar) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1% penicillin-streptomycin (VWR, 5 units/mL penicillin ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM dithiothreitol (VWR) in 384-well plates (Corning ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM dithiothreitol (VWR) in 384-well plates (Corning ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... 1 cover glass (VWR) was used for the top plate and a 40 mm cover glass (Fisherbrand ...