Labshake search
Citations for VWR :
5751 - 5800 of 8568 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... using a Precellys 24 homogenizer and ceramic bead tubes (VWR, USA) at 6000 rpm for 30 sec ...
-
bioRxiv - Bioengineering 2021Quote: ... Then 8mL of clarified lysate was added and the column was sealed and placed on ice and nutated (VWR 12620-916) for 10 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... PKCδ was visualized using the Amersham Enhanced Chemiluminescence Western blotting detection system (VWR, Mississauga, ON, Canada). Band intensity was quantified using Image J software ...
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Microbiology 2021Quote: ... a glass slide (VWR) was placed and strongly pressed down to obtain smaller pieces ...
-
A bacterial signal transduction phosphorelay in the methanogenic archaeon Methanosarcina acetivoransbioRxiv - Microbiology 2021Quote: ... H2O up to a total volume of 10 μl was combined in a sealed short thread vial (VWR). For reducing condition freshly prepared DTT was added to a final concentration of 2 mM ...
-
bioRxiv - Microbiology 2021Quote: Groundwater samples were collected in sterile 350 ml PETE bottles (VWR, UK) and transported as described above ...
-
bioRxiv - Microbiology 2021Quote: ... pH and electrical conductivity were determined in the field using pH-110 meter (VWR International) and Elite CTS Tester (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells grown on glass coverslips (VWR Life Science) were washed in phosphate-buffered saline (PBS) ...
-
bioRxiv - Cancer Biology 2021Quote: ... LiCl (# EM-LX0331) and DMSO from VWR Life sciences (Carlsbad ...
-
bioRxiv - Cancer Biology 2021Quote: MCF7 KRT19 KO cells that were generated using the CRISPR/Cas9 system (Sharma et al., 2019a) and isogenic parental control cells (ATCC, Manassas VA) were grown in Dulbecco’s Modified Essential Medium (VWR Life Science) containing 10% fetalgro bovine growth serum (RMBIO ...
-
bioRxiv - Neuroscience 2021Quote: ... Coverslips were mounted on slides (VWR, 631-0847) with mounting media (Merck ...
-
bioRxiv - Neuroscience 2021Quote: ... Seed protofibrils were then prepared by sonicating the above incubated fibrils for 10 minutes using a 550T Ultrasonic Cleaner (VWR International, Radnor, PA). Note that the mature fibrils prepared by 23-day incubation were not processed ...
-
bioRxiv - Neuroscience 2021Quote: Antennal sections were prepared by depositing dissected antennae into OCT Mounting medium for cryotomy (VWR, vwr.com) and frozen at -80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... counterstained using Nuclear Fast Red (VWR, cat.no. 342094W) and mounted using Eukitt quick-hardening mounting medium (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... glass slides and coverslipped using Fluoromount (VWR, 0100-01).
-
bioRxiv - Neuroscience 2021Quote: ... mounted in consecutive order onto Superfrost Plus (VWR, 48311-703) glass slides and coverslipped using Fluoromount (VWR ...
-
bioRxiv - Microbiology 2021Quote: ... 4 °C) and subsequently filtered into 1.5 mL short thread vials with crimp caps (VWR International GmbH ...
-
bioRxiv - Neuroscience 2021Quote: ... Corning 35 mm uncoated plastic cell culture dishes were purchased from VWR, 12 mm circular cover glass No ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by 10% Formalin/PBS (VWR, Radnor, PA, USA). Brains were postfixed in 10% Formalin/PBS for 24-48 h at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... and either collected on superfrost slides (VWR) (14-16μm-thick sections ...
-
bioRxiv - Neuroscience 2021Quote: ... blocked with PBS containing 10% fetal bovine serum (VWR, 97068-085) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Twelve µm thick coronal sections obtained on a cryostat were mounted on glass slides (VWR, 48311-703), and treated as described (Feiner et al. ...
-
bioRxiv - Bioengineering 2021Quote: ... Aerosolized VHHs were collected into 15 mL round-bottom polypropylene test tubes (VWR, Cat#C352059) for 5 min to allow condensation and were subsequently quantified and kept at 4°C until use ...
-
bioRxiv - Bioengineering 2021Quote: ... 100 µM of D-(+)-biotin (VWR, Mississauga, Canada; Cat#97061-446) and bacterial cell extract overexpressing E.coli BirA as described 81 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of each reaction were mixed with loading dye and analyzed on a 1% (w/v) agarose gel containing GelRed (VWR, Darmstadt, Germany). The remaining PCR mix was purified using a QIAquick PCR Purification Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... Analytical metal standards of 0 – 500 ppb were prepared by serial dilution from individual metal stocks (VWR, UK) and were matrix-matched to protein samples ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were mounted onto micro slides (VWR International, LLC). Vectashield Hard Set Mounting Medium with DAPI (Vector Laboratories ...
-
bioRxiv - Microbiology 2021Quote: HEK 293T cells (3×105 cells) were plated on the sterilized round 15mm #1 glass coverslips (VWR) in 12-well plates and seeded for 24hours prior to transfection ...
-
bioRxiv - Physiology 2021Quote: ... Sections were then developed using Kodak D-19 developer (VWR) for 5 min ...
-
bioRxiv - Physiology 2021Quote: ... Tissue samples were embedded in paraffin and sections of 4 μm were coated with 43–45°C Kodak NTB emulsion (VWR, Herlev, Denmark) diluted 1:1 with 43–45°C water ...
-
bioRxiv - Microbiology 2021Quote: ... FBS (VWR) and 100 units/ml penicillin-streptomycin (Corning).
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 1mM ATP (VWR), and 10% sucrose using a Hemotek artificial blood-feeding system (Hemotek ...
-
bioRxiv - Microbiology 2021Quote: ... were maintained at 37°C under 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) (Wisent) containing 5% fetal bovine serum (VWR) and 100 μg/ml penicillin-streptomycin (Wisent) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then subcultured 1:1000 into 7 mL of MSgg in a 6-well polyvinyl plate (VWR, PA, USA). Plates were incubated in static conditions at 30°C for 3 days and were then imaged using a Leica MZ10F macroscope and Leica DMC2900 camera ...
-
bioRxiv - Cancer Biology 2021Quote: ... and dried in a SpeedVac (VWR). Using a Dionex UltiMate 3000 RSLCnano system equipped with a Dionex UltiMate 3000 RS autosampler ...
-
bioRxiv - Microbiology 2021Quote: ... 300μl of cold 80% Nycodenz (VWR 100356-726) was aliquoted to the bottom of 2 ml microcentrifuge tubes and 1.6 ml of stool slurry was overlaid on top without mixing the two phases ...
-
bioRxiv - Microbiology 2021Quote: ... and then placed on an orbital microplate shaker (VWR 12620-926) at 1200 rpm for 30 seconds to further mix the cells while keeping the mix at the bottom of the wells ...
-
bioRxiv - Microbiology 2021Quote: ... purified cells were diluted and imaged at 100x magnification within a 20 μm counting chamber (VWR 15170-048). Images were analyzed using FIJI/ImageJ 1.52p (Java 1.8.0_172 ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 100 μg/mL of 5-florocystosine (5-FC) and grown at 24°C as listed in Supplemental Table S1 (Stork et al. 2008) (VWR, Radnor, PA, USA). A 10 mg/mL stock solution of 5-FC was prepared in distilled water and filtered sterilized ...
-
bioRxiv - Cancer Biology 2021Quote: ... the tissue was first blocked for 30 min using a blocking buffer (TBS with 1% BSA (VWR, 22013, Bovine Serum Albumin (BSA), fraction V ...
-
bioRxiv - Immunology 2021Quote: ... collected on Superfrost Plus glass slides (VWR international; Leuven, Belgium) and dried overnight at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... and supplemented with 0.1% bovine serum albumin (BSA, VWR, Cat #0332). After loading ...
-
bioRxiv - Synthetic Biology 2021Quote: ... We used 80 ml glass bottles (VWR, Radnor, PA, USA) for the 50 ml cultures ...
-
bioRxiv - Microbiology 2021Quote: ... the blots were blocked in TBS (VWR, Radnor, Pennsylvania, USA) containing 0.1% Tween-20 and 5% non-fat milk ...
-
bioRxiv - Bioengineering 2021Quote: ... Vascular compartments were coated with a rat tail collagen type I (VWR) solution of 0.1 mg/ml in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Bioengineering 2021Quote: HEK293T and K562 cells were cultured with 10% fetal bovine serum (VWR) and 1% Penicillin/Streptomycin (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... Whole blood cell lysates or lysates of PBMCs from IL-1-Ra-Ab positive patients were treated with alkaline phosphatase as previously described using FastAP thermosensitive alkaline phosphatase (Fermentas/VWR, Darmstadt, Germany).(40 ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell culture plasticware and disposables were purchased from VWR (VWR, USA). L929 cells were maintained and cultured in DMEM supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... All cell culture plasticware and disposables were purchased from VWR (VWR, USA). L929 cells were maintained and cultured in DMEM supplemented with 10% FBS ...