Labshake search
Citations for VWR :
451 - 500 of 1075 citations for 6 Methyl 3 5 heptadien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/streptomycin (Wisent) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5% w/v RNase free BSA solution (VWR, No. 0332-25G) is poured over the paper ...
-
bioRxiv - Biochemistry 2021Quote: ... supplemented with 5% (v/v) heat inactivated fetal bovine serum (VWR). Cell line authentication was provided by the American Type Culture Collection ...
-
bioRxiv - Biochemistry 2022Quote: ... 5-10% inactivated fetal bovine serum (FBS; VWR Canada #97068-085) was added and the stock was stored at 4°C.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared ...
-
bioRxiv - Cell Biology 2023Quote: ... were dried to a 5 mm coverslip (Mentzel Glasser #1, VWR) and mounted on the sample holder using vacuum grease (Dow Corning high vacuum grease ...
-
bioRxiv - Neuroscience 2023Quote: ... in mTeSR plus 10 μM ROCK inhibitor (VWR, cat. #688000-5). The 96 well-plate was then spun at 330 g for 5 minutes to aggregate the cells and make spheroids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Cetylpyridinium chloride (CPC; 99% purity, VWR; CAS no. 123-03-5) was prepared in aqueous Tyrodes buffer (Hutchinson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... 5-10% inactivated fetal bovine serum (FBS; VWR Canada #97068-085) was added and the stock was stored at 4°C.
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% uranyl acetate and 5% H2O in anhydrous acetone (VWR, Germany) pre-cooled to −90 °C .The FS was performed in a Leica AFS2 (Leica ...
-
bioRxiv - Biophysics 2023Quote: ... and nuclease-free water (#7732-18-5) from VWR (Vienna, Austria). 14C-malic acid was purchased either from Perkin Elmer (Waltham ...
-
bioRxiv - Molecular Biology 2023Quote: ... then neutralized with 1 μL 5 M HCl (VWR BDH7419-1). The remainder of the library preparation was performed according to the xGen protocol except that post-ligation ...
-
bioRxiv - Microbiology 2024Quote: ... we added 5 mL of 1X Phosphate Buffered Saline solution (VWR) to the samples and centrifuged them (17,000 x g ...
-
bioRxiv - Cancer Biology 2024Quote: ... The incision was sutured with 5-0 Vicryl (VWR, 95056-936) with application of topical bacitracin ...
-
bioRxiv - Neuroscience 2024Quote: ... embedded in 5% low-gelling temperature agarose (VWR International, Erlangen, Germany), placed in ice-cold oxygenated S2 ...
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 5% fetal bovine serum (FBS) (VWR, Radnor, PA, USA) and 100 U/mL penicillin/ streptomycin (Wisent).
-
bioRxiv - Microbiology 2019Quote: ... Pellets were thawed on ice and resuspended in 250 μL of PBS supplemented with 1 M NaCl and 6 M Urea (VWR). The resuspended bacteria were then added to screw cap microcentrifuge lysing tubes (Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: For transductions VeroE6 or HEK cells were seeded into greiner CELLSTAR® 96-well plates or 6-well plates (VWR) containing lentivirus in DMEM containing 2 % FBS and 1 μg/mL polybrene ...
-
bioRxiv - Microbiology 2020Quote: ... animals were randomly assigned to individual cages under one of four groups (n=8 per group): Wild-type (WT) C57BL/6 mice with access to a free running wheel (VWR) or a locked wheel (SED) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then subcultured 1:1000 into 7 mL of MSgg in a 6-well polyvinyl plate (VWR, PA, USA). Plates were incubated in static conditions at 30°C for 3 days and were then imaged using a Leica MZ10F macroscope and Leica DMC2900 camera ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.4 µm TC Plate Insert with a PC Membrane 6 well plate (thinserts) was purchased from VWR (Radnor Pennsylvania, USA). PD-L1 ...
-
bioRxiv - Biophysics 2022Quote: ... The peak fractions containing SA1 were pooled concentrated to 1ml final volume and was purified via size exclusion chromatography using a Superose 6 increase 10/300 GL column (VWR). Peak fractions were collected ...
-
bioRxiv - Microbiology 2022Quote: ... The in-house polyacrylamide TBE gels (40 ml) for horizontal electrophoresis were produced by combining 6 ml 40% Acryl/Bis 29:1 (VWR), 4 ml of 5x TBE ...
-
bioRxiv - Neuroscience 2022Quote: Peptides were solubilized in 6 μL buffer A (100% MS-LC grade water and 0.1% Formic acid (VWR Cat#84865.180), and a total volume of 3 μL were loaded onto a 30 cm-long column (75 μm inner diameter (Polymicro Cat#TSP075375) ...
-
bioRxiv - Molecular Biology 2023Quote: Recombinant Jag1-Fc was immobilized by overnight incubation at 4°C in individual wells of non-tissue culture-treated 6 or 12 well plates (VWR) at a final concentration of 2 µg/mL in DPBS containing 10 µg/mL poly-D-lysine (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... PSCs from 80% confluent wells of a 6-well plate were plated onto a 12-well plate previously coated with reduced growth factor matrigel (VWR) in E8 media (d0 ...
-
bioRxiv - Microbiology 2024Quote: Cells from bone marrow of 6-10-week-old male or female wild-type or Myd88-/- Ticam-/- Mavs-/- (49) C57BL/6 mice (see Table S1) were cultivated in RPMI 1640 (VWR) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2024Quote: Boiled protein samples were analyzed by SDS PAGE on 6% acrylamide stacking gel and 8% acrylamide resolving gel and transferred to 0.45μm nitrocellulose blotting membranes (VWR CA10061-120). Membranes were incubated with primary antibody overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: A total of 1-6×106 cells per sample were exposed for 6 hours to media alone (R10 media, consisting of RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS, VWR), 1% penicillin (GIBCO) ...
-
bioRxiv - Microbiology 2020Quote: ... We washed the pelleted biomass 1 – 2 times and resuspended it with 50 µL 1x PBS from which we fixed 2 µL on solidified agarose (VWR, Solon, OH, USA) (1% w/v) ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures for experiments were grown in flat-bottom 3 L polycarbonate Erlenmeyer flasks (VWR, Germany) at 22-25 °C ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 l ...
-
bioRxiv - Immunology 2022Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Bioengineering 2020Quote: ... (3) we then pipette the solutions vigorously in a 20 mL scintillation glass vial (VWR) with a hydrophobic coating which is introduced by incubation with Rain-X (ITW Global Brands ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60μl ...
-
bioRxiv - Immunology 2021Quote: ... samples were diluted at 3-fold in 8 serial dilutions using DMEM (VWR, #45000-304) in duplicates with an initial dilution of 1:10 in a total volume of 60 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were selected for five days in presence of 3 μg/ml puromycin (VWR, CAYM13884). A near 100% GFP-positive population was confirmed via microscopy (ZOE Fluorescent Cell Imager ...
-
bioRxiv - Cancer Biology 2023Quote: ... fluorescence intensity (∼485 nm/∼530 nm) was measured using FlexStation 3 Multimode Plate Reader (VWR).
-
bioRxiv - Microbiology 2021Quote: ... a 20 µL reaction mixture containing 10 µL of Quanta qScript™ XLT One-Step RT-qPCR ToughMix® (VWR, Radnor, PA, USA; #76047-082), 0.5 µM Primer E_Sarbeco_F1 (ACAGGTACGTTAATAGTTAATAGCGT) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... A 5 mL syringe mounted on the infusion pump was connected to a swivel coupled with a spring leash (C313C; Plastics One; Roanoke, VA, USA) and Tygon® tubing (AAQ04103; VWR; West Chester, PA, USA) suspended over the chamber’s ceiling on a balanced metal arm ...
-
bioRxiv - Bioengineering 2019Quote: ... then wrapped them with 2” parafilm (VWR, cat no. 52858) and stored at room temperature for 1 day ...
-
bioRxiv - Neuroscience 2019Quote: ... then transferred to 2% dimethyl sulfoxide (DMSO: VWR, Radnor, PA) solution for cryoprotection for 1-2 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... all media contained 2% dextrose (BD, VWR catalog #90000-904), 0.67% YNB with nitrogen (Sunrise Science ...
-
bioRxiv - Biochemistry 2020Quote: ... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were plated on No.2 VistaVision cover glasses (VWR). For hydraulic chamber experiments and immunofluorescence ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... After centrifugation (500g, 2 min) (Centrifuge 5417C, Eppendorf, VWR, Belgium) to remove large particles ...
-
bioRxiv - Cell Biology 2021Quote: ... plus 2% glutamine (BioWhittaker) and 10% bovine calf serum (VWR). Cos-7 cells (a gift of Dr ...
-
bioRxiv - Microbiology 2022Quote: ... 1-BuOH ANALAR and 2-propanol HPLC grade from VWR international GmbH ...