Labshake search
Citations for Zymo Research :
301 - 350 of 6157 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were cleaned by spin column purification (Zymo, Inc.) and DNA eluted in 20 uL of Tris-HCl ...
-
bioRxiv - Systems Biology 2022Quote: ... The PCR products were cleaned using DNA Clean & Concentrator (Zymo). The ligation product was assembled as following ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then PCR products were column purified (Zymo Research, Cat# D4004) and Sanger sequenced (Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... purification of PCR products (DNA Clean & Concentrator-5, Zymo Research), gel extraction (QIAquick Gel Extraction Kit) ...
-
bioRxiv - Neuroscience 2019Quote: ... Beads were then washed several times with buffers and RNA purification was performed on eluted beads (Zymo RNA Clean & Concentrator −5 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... PCR products were concentrated using DNA Clean and Concentrator (Zymo, D4013) followed by 0.8X SPRIselect (Beckman Coulter ...
-
bioRxiv - Cell Biology 2021Quote: ... The PCR product was cleaned (Zymo DNA clean and concentrator-5) and then sent to Genewiz for 2 x 250 bp amplicon sequencing (Amplicon-EZ service) ...
-
bioRxiv - Genetics 2022Quote: ... PCR products were purified by DNA clean & concentrator-25 (Zymo Research). In vitro transcription was performed by incubating 5 μg of transcription template with NTP ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was purified using One Step PCR Clean Up (Zymo Research). The DNA was quantified using Qubit dsDNA HS Assay Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR inhibitors were removed from the resulting gDNA (Zymo Research, D6030) and the concentration of the resulting gDNA was measured using the Qubit dsDNA HS assay kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final amplicons were subjected to PCR clean up (Zymo D4004) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: MSP1-specific B cells that successfully expanded in culture were collected by centrifugation (5 min. at 250 × g and RT) and stored at -70°C in 50 µl Tri-Reagent (Zymo #R2050-1-200). Heavy and light chain variable regions were amplified from MSP1-specific B cells by cDNA synthesis and a series of PCR reactions ...
-
bioRxiv - Microbiology 2020Quote: ... 75μl supernatants were collected at 48hpi and inactivated 1:1 in 1X DNA/RNA Shield for RNA extraction and RT-qPCR analysis (Zymo Research, Irvine, CA). RNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... supernatants were collected at 48hpi and inactivated 1:1 in 1X DNA/RNA Shield for RNA extraction and RT-qPCR analysis (Zymo Research, Irvine, CA). RNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting PCR products were purified using DNA Clean & Concentrator (Zymo, D4013) and were sent to PSOMAGEN ...
-
bioRxiv - Immunology 2019Quote: ... The PCR product was purified using DNA Clean &ConcentratorTM-5 (Zymo, D4013), eluted in nuclease-free (NF ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were purified using DNA Clean and Concentrator-5 columns (Zymo) and subsequently analyzed by Sanger sequencing.
-
Insights into the secondary structural ensembles of the full SARS-CoV-2 RNA genome in infected cellsbioRxiv - Biochemistry 2021Quote: ... The PCR product was purified by DNA Clean and Concentrator −5 (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... or single-nuclei (in 96-well PCR plates provided in the Zymo EZ-96 DNA Methylation-Direct™ Kit loaded with 4µL Proteinase K digestion buffer (1µL M-Digestion Buffer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Each PCR product was purified on a column (Zymo DNA Clean & Concentrator) and eluted in 10 μL prewarmed 65°C provided elution buffer (Zymo) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Yeast colony PCR was performed using Zymolyase Yeast lytic enzyme (Zymo Research) to lyse the cells ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was purified using DNA Clean & Concentrator-5 (Zymo Research), sequentially digested with FastDigest SfiI and FastDigest DpnI (Thermo Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were purified using Zymospin V columns (Zymo Research, C1016) and then by Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2023Quote: PCR products were purified using DNA Clean & Concentrator™-5 columns (Zymo Research Europe GmbH ...
-
bioRxiv - Genomics 2023Quote: ... Final PCR product was purified with DNA clean & concentrator (Zymo Research D4013). The primer pairs CRISPRmap-F and CRISPRmap-R in Supplementary Table 6 were used in both rounds ...
-
bioRxiv - Systems Biology 2022Quote: ... the second sample was stored at RT for 3 – 5 days and the third sample was collected in a Zymo research tube (Zymo Research Inc., Irvine, CA, USA) containing 9ml DNA/RNA shield and stored at RT for 3 – 5 days before storage at −80 °C ...
-
bioRxiv - Microbiology 2022Quote: ... Gel extraction kit and DNA purification kit were from Zymo Research ...
-
bioRxiv - Genomics 2020Quote: ... Eluted DNA was treated with Zymo OneStep PCR Inhibitor Removal columns (Zymo Research). Extractions were performed in a UV-sterilized laminar flow hood and all extraction instruments and bench spaces were sterilized with a 10% bleach solution or UV light ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR-amplified DNA was purified and concentrated by spin column (Zymo Research #D4004) before being used to generate RNA.
-
bioRxiv - Genetics 2022Quote: ... PCR products were purified using a Zymo DNA Clean & Concentrator column (Zymo D4003). Size selection was performed on a 8% TBE-urea gel ...
-
bioRxiv - Genomics 2021Quote: ... Eluted DNA was treated with Zymo OneStep PCR Inhibitor Removal columns (Zymo Research).
-
bioRxiv - Synthetic Biology 2023Quote: ... PCR products were column-purified before cloning using DNA Clean & Concentrator (Zymo research).
-
bioRxiv - Microbiology 2023Quote: ... PCR products were pooled and concentrated using DNA Clean and Concentrate columns (Zymo). Insert (sgRNAs ...
-
bioRxiv - Immunology 2023Quote: ... PCR product/library were purified using DNA Clean and Concentrate-5 (Zymo Research) then ran on a tapestation to visualize nucleosome distribution ...
-
bioRxiv - Neuroscience 2024Quote: ... The PCR reaction product was cleaned (Zymo DNA Clean & Concentrator Cat. No D4013) and sequenced (Genewiz ...
-
bioRxiv - Molecular Biology 2023Quote: ... Round 1 PCRs were cleaned using DNA Binding Buffer (Zymo ZD4004-1-L) and UPrep Micro Spin Columns (Genesee Scientific 88–343) ...
-
bioRxiv - Microbiology 2024Quote: ... followed by pooling all PCR reactions and column purifying the product (Zymo Research). PCR products were 5’ phosphorylated with T4 polynucleotide kinase ...
-
bioRxiv - Cell Biology 2019Quote: RNA was isolated using a commercial kit (RNAmicro kit, Zymo Research), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid is extracted from the bacterial culture using a 96-well mini-prep kit (Zymo kit, Zippy 96 plasmid kit). All clones are sequenced by Sanger sequencing at the site of the barcode using primer ACTTGTGTAGCGCCAAGTGC ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were purified using the DNA Clean & Concentrator-100 (Zymo, Cat. No. D4029) and sent for Sanger sequencing using a TIDE forward primer (Supplementary Table) ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification products were later purified using DNA Clean & ConcentratorTM −5 (Zymo Research, # D4004) following the protocol provided by the manufacturer.
-
bioRxiv - Biochemistry 2019Quote: ... PCR reactions were purified using a Select-a-size DNA Clean and Concentrator (Zymo) to remove adapter dimers ...
-
bioRxiv - Genomics 2021Quote: ... The PCR product was purified over a Zymo Clean and Concentrator column (Zymo Research), digested with AvrII and BglII ...
-
bioRxiv - Cell Biology 2023Quote: ... The amplified PCR products were purified using DNA Clean & Concentrator-5 (Zymo Research, D4014) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... and gel extraction kit (Zymoclean Gel DNA Recovery Kit) were from Zymo Research ...
-
bioRxiv - Bioengineering 2022Quote: ... using a commercial kit (ZymoPURE II Plasmid Maxiprep Kit; Zymo Research Corp). HEK293Ta cells (Genecopoeia ...
-
bioRxiv - Microbiology 2019Quote: ... at 48 hpe cells were washed 3 times with PBS to eliminate extracellular virus and total RNA was extracted using Direct-zol RNA MiniPrep Plus (Zymo Research) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Chronotype was assessed by computing mid-sleep time on free days (MSF).2 Participants’ stool samples were collected using DNA/RNA Shield Fecal Collection tubes (Zymo research). Sample DNA extraction was performed using the PureLink Microbiome DNA Purification Kit (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: 10 μl aliquots were removed at given time points and desalted using a ZYMO Oligo Clean & Concentrator spin column (ZYMO Research). The isolated material was resuspended in 30 μl 100 mM Na+-HEPES (pH 7.50 ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmids used for nucleofections were purified by Zymo midiprep kit (Zymo D4200) and concentrations were quantified by absorption at 260 nm ...